Description :
From Genome Similarity Track
Location :
Scaffold_76:7790- 12533
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh_masked-piw_contig_76-abinit-gene-0.2Protocadherin Fat

Sequence
4743 bases(100 bases per row)
CCAGAATCCGAGTCGATAGCGAAAAGATCAGAGGTCGCACTGTCATCTTTCATCGAGAACGCCACAGTGTCATAGGAATCAGGATCTGTGGCATGAACTA
CGCCAACCGATGAGTGCGCTTCTGCAAGCTCGTGGACAGCCATCGTGTAGTCTTGATACTGGAACCTCGGTGACTCAGGAGCGTCAATCACGTACACGTT
GATCTGAAAAGGCACAGACACTTTGTCGAATGTTACCATGGCTCCACGTACGCTTAGAAATGGTGAGACATGCACGGAGCTTGGAGAATAGCCTTGTTGA
AGTCGCACCAGCGCCTCGAAGTCGCACGCTTCGTCGCCAGAGTACAGTGAACCGTCAGGTTTTAGGCGAATCGATCCGGACACTGGAGTCGTTTCATCAA
GAACGAACGAGAAATTGTCTCCTTCTGGATCCAAGCCTCGGAGCTGACCGATTACAACACCAGGAGCGGAATTCTCCAACACCTTCAGGTTGAGTGCTGA
CGCGACAACCAAAGCTGGAGGCTCGTTAACATTGTCAACGAAGATAACAACGCGGACGCTGTCGGAGAGGAAGCCCACACCAGTGTCCGTCACCGTTAGC
TGGATGTTGAACATTTTCTGCGTCTCATAGTCAAACGCGTCATGAAAAGACACCACGTCACACGATCTGTCGCCCTTCTGAATAACTCGAGATATCGCTG
CTGGATCGGAGATAATCGTGTAGAACAGGCGCTGGTTCGCGTCCTCGTCGCGAGCTTCAAATCGGCTCAAGAGAGTGCCGATCGCGATGTTTTCCTTTAT
TCGGATGCAAATGTGCTCGTTCAAGTCGTATCGCTCTCGAATCTCATTTTGCTGGTCAACAAAGCAGTTTCGCTGGAACTTCGGGGCTTCATTCAAGTCC
TCAACGTCGACCTGAAGGGCAGTTCTCGCTGTGTTCAGAGCGCTGTCTGTGATCACCACGTTGAACAAGTACTGCGCAGTTGTTTCATAGTCGAGTGAGC
CATTCACAGTCAATTGGCCCGTGAGTTCATCGAGCTGGAACGGTAGATCGATCAGTATCGATGGCGAGTACTCGATTTGATAGCGAAGAACGTCGAACTC
GTCCTCGTCGATTGCCTCAAGAGCCATGCCGACGTGCGTGTGCAGCTGTGAGTTTTCGGAAATCGTTCTCTTGGTCACACTTGCAATCACAGGCGCCTCG
TTCACGTCCACAAGATCCACGGTCACCCGACACGTGGACGACAGCGACGAGATCGCTTTTCCCACACTGTTGTCGCCGCTCACAAAACTGTCAGCAATGC
GCAAATCAATGTGCAGCGTCGGGTGTTTTTCATAGTTCAAGGCGCTCAAATCACGAACTACGAGAGAGTACTTTGTAGTCGCTTTCACGACTGCAAACGC
ACTATACACCACGTCATCTGGTAGGCTCACGATCTCGAATGCTGTGATCGTGTTCCTCTCCGGCGTATCCGAGTCACTCCATCTTAGCTCGCCAACAACG
GTACCTTGTGGTGAATTCTCATTCAGACGGAAAGTTGAATCATCACAGGAGGGTGGCTCATTCACATCCACAATTTCAATCGAGATCTTGTCGGAAGTTG
TGCTGAGCCCATAGCGATCTTTCGCGCGAATCCGAATGCTGAAACCCACATGTGCTTCGTAGTCGAGCGAGTTGTCACCACTCAAGCGGATCTCTCCGTC
GCATGAGTGGATCGTGAACAAATCGACGGAAGCGCCGCTTTGGTCGAGAGACTCGAAGATCTCATACGAGATAGCGTCGTACATGTCGGGATCAAATGCT
GCCACTATAACGCCAACGAACGCTCCTCGTTGCGACTTTTCATCGATCTGAAAACTCTTTTGCGGCGGGAACACTGGTGGCTCGTTCACGTCGACGACGT
TGATGCGGATCACTGCAGTGCTAGAATGCCCTTGATCGTCGGCTGCGGTTACAATCATATCGTAGTATGGTGTAGTCTCGTAATCCAACCCCGCAGTGAG
CTGGATCAAACCGCCGAATATTGCGATGGAGAACTTCGTCGTCGAGTTTTGGGTCAGTGATATTGTGTTGTTCTCTGGATCCCATGCCGAAATCGAAGCT
CCAACGGCGGTCACGCAATCGGAGCACAGCGCTATTCCCGAGCCAATGGACGCTGATTCTTTGATCCAGAAACTCTGTGAGACAATCACAGGCGACTCGT
TGATGTCCAGAATCAAGATCTGGACTTGCCCGTTGCAATTCAGATGCGCTCCATCCACCGCCTCGATCTGCAAGACGACAGGCCGCTGAAACTCGTAGTC
AAACGGCTTGGTTGCTGCGATTTCCCCCAAGGCGCTGATGGTGAAGAAAGCAGCACTGCCAGAATTTGAATCGCTAAGGATACTGTAGGAGAGAGACCCC
CACTTGGTCATAACGGACGCCGCATCAGGATCAGAGGCGGTGATAACGCCAACAGCGCCGATCGAGTTCTCTGGGATACTGAATACAGCTACCTGGTCGA
GAAAGCTGCAGGCCTCGTTGACGTCCAAAATTGTGATTGTGACGACCCCACTGACTGATTGAGTCGGTGAGCCGCTGTCTGCAACGGTTGTGGTGACGCG
AATCTCACGGATGGCTTCAAAGTCGAACCAGGTAGCATCACGAACTTTGAGACCGCCCGTCTTCCTATCCACAGCCACCACATCGGATCTCGACACCGTG
GAATTGTCATCCAATAGTAGAACTGTCGTGTTGATCACGAACTCGTGCGTCTGTCCGGAATCTTGATCTTGTACGGCCACTACGCCGATCACAGCGCCTG
GTTCCGCGTTTTCGTGGATCGAGAAGTCAAACGAAATCAAACTTGGCGCGTCATTGCGATCCAGAACCATAACAGTCACTGTCGTAGTGGACATCAGCCC
GCCCGCATCAGTTGCAAAAATCACGATGGTATAGAGCGACACGGTCTCGTAATCCAGCAGCTTCTTCGTGAAAATGGTTCCAGATGCTGCGTCGATGCCA
AACATTGCAGACGAGTCTTCTATCACAAACGACAGCACGTCACCAACATCCGGATCACTGGCGAGCGCAGTTCCGTTGACAATGTCCATCAAGCTGGAAT
TTGTGCTCAGTGGTGTGGAAATAATCGTGTCTTCTGGAACGTACAACAGTACACCAGCACTCATCTTTGGTGCTTCGTTCACGTTTGTCACTGCGACGTG
GACAGTTGTGACAGCGCAAAGTGCACTTGGTCCATTATCGTGAGCTCCAACCACTAGAGTAAAGGCGTTCTGGCGTTCAAAGTCAAGCGCGGGGGCATTG
TTGACGTATAACCTGCCAGTTCCTCCGACAGACGAGATCGCAAATGTGTCCAGGATGTTTCCACTAACGAGCGAGTACACGAGCGTGTTGTTCTGAAACG
TGTCCGTATCCAAAGCGACGAGTGTTCCCACGAGTGTTTGGCTGACCAAGTTCTCTTGAATCACAAAGGAGTATACGCTGTTCTTGAAGACTGGCGCCTC
GTTACTGTCCGTGACACTGATCAACACCGTCGTGCGGGCTGAAAGACCCCACTGGTCGTCCACGAGCGCTGTGAGCTGGTACGACTGCTGCGTCTCATAG
TCGAGAGAGCCATTCAAAGCAATTGCGCCATCACCGGAAATCACAAACGGCGGACAGGAAGACGTGCCTGCTGCTGAGCCCAGCGCAAAACGAAAAGCGA
GAACTGAATTTGCATCTGGGTCTCGAGCAGTAAGGTATCCAATGAAGGTGCTGTTGGCAGCGCTCTCGCTAACAGAGAACGCGTACACAGACTTCAGAAA
TACTGGAGGCTCGTTCACGTCCACAATGTTGAGGTAGACGATAACAACAGCGTTCATGGCAATCTCGTTGACTGTGTATGCGAGTGCGCTCAACAGCACG
ATCTTCAATTCACACGAGCTCAGCGTCTCATAATCGAGCAAACCTTCCTCCAGGCGCAGTTGGCCACAAGTGTCGACCGAAAAGGTTCGATTCGCTCCAC
AGGTGCTCTCCATTACACCAGGTTGGAGTTCACACGTTTCAGCAAGGGGGTTAACGTCTTGTTCATCAACGACGTAGATCCCCAACGGAGTGCCCACGAC
GCCACCTGTGTTCAGATCTTCCTTCACAGCAAACTTCACAGACTCGCGAGTGAAGTATGGAGGCTCGTAGACGTCTTCCAAACTCACGATGAACTTCAGA
GAGGCTGTGAGGTTCGCTCTATCTGCAACGCAAACGTCCACCCAGAAAGTTGGCGTGCGTTCGAAATTCAAAGCCGAAGTGTTGAGCACGATGAGTTGTC
CAGCATTGCTTCCGTGTGAATTCTGAACCAGAAAAGTGCCGAGCTGGCTTTGTCCACAGTCCCAGTACGCCAGTACGTCGTTCGCATCAGGGTCCACAGC
GTGGAACAGAGACACACGGGTTCCTGCTGCTGTGTTCTCGTTCAGTAGAACCACAGATCTCTCTTCATCAAACGCTGGAGCTTCGTTCACGTCCGTCACG
TAGATGAATCCAATCACCTTCGCGACCAAGTCTCCGTCCGAGACCTCCAGAGTGAGGGAGAAGAAATTTCTGGTGGCCGTCTCAAAGTCCAAAGCGCAGC
CAATAGCCAATGTAAGCACCCCCGAGGAGCGATTGGCGACAAAGCAGTTACTCTGTCCAACGTTCGTTTGCGCAATCGAATACATCAAAATGGTGTTTTT
GTCTGGATCCGACGCGAGAATGTGGTAGCCAATCAAAGAACCT