Description :
From Genome Similarity Track
Location :
Scaffold_260:779- 8566
Sequence
7787 bases(100 bases per row)
ATCCGTGATCGGCTGAACTTGTTCTCACCTTGTGTACCCGTCGGCGGGCTGGATATGCTCTCTCGGGGCTCCGAAGATGCAGAACTTGGTGAAGATCGAG
TGTCTTGGCGTGACGCGGGGATAGTTTGTGGGGCAGCGCGGTAGTCTTCGCTCTGCGTCCGAGTATACGCTCCGATCGAGGGTTGTTCGCTCCGATCGGT
CGGCCTGGAGTTGATCCAAGGCCTGTAGTCGCTTTTCCGGGTGTGTTCCTTCCTTTCCTGAGTTGCTTGCCGCTTCCTATAGCGGGATCGAGGTTGATCG
AGAGGAGAAACGATCGCCGGTCAAGCACTAATATCCGGTCGATCGAGGACTTGCACACAAGAGATAGATCACTAGAGTAGGTCAAGCTGGCCAATGAATT
AATCCAGTCTTAACCGTACCGCTAGTTCACTACCCAAAGTGTCGACCCTGCCGAGGCCAATGTAGTTCCTGGGACTTGGTGACTTGAGGGGACTTGTGCT
CTTCGGTGCAATTTCTGCTCGAGAGCGACTTGCCGGGGCTTGGTGGTCTTGGATCACGCGTGGGGTCAAATCTGTTCTCCACAACGCAAGTCGATCGAGG
CCAATATGCTCTTCCTCCTCGAGATTCCAGACCACTTGCGCTCCACGGTGCAAATTCGACTCTGATTTATGTTTAGCTGGTCTCTCCCTAATGCTACCAT
CTTGCTTACCCTCCTACAACCACACGATTACTGGATTCTTGCCCCGACTTCGTCCTTCATGTGCGTCCCATCCTGGTCGATCCACGATCGGCCCCGATCG
GCGATCGACTCCGATCGGCCCTGATCGGCGATCGACGATCGACTCCCGTCGGCCCTGATCGGCGATCGACCCCGATCGGCGACCCACGATCGGCTCCCGA
TCCACGATCGACCTCGATCGGCGATCGGCGATCCACTCCCGATCGATGACTTATGCCGGTTGCCATGCGCCGCCGATCTATCACCTTCTGTCCTCGGCCA
TCTCAGATCCGCGGGTTCTGTCGTCGATCTGGACTTGGGTCAGCCACGAATCACGCCGCGGTTCGGGCACGATCACCCACAATCCGGCTTGCCACATGTC
CTGCCTTACGCGCCGGCGTCATCGGACCACCTGAGGTCTCCCGAAGAACTCCTTCCGATCCGTAGATCCTTGCTGCCAGTCTCTCGATCGCCGATCTCCC
ACGCCTCCAGTCGATCGGCCCAGCCGCCTTTCTCGGAGAACAATTCTTATTCAGCACTTCTCCACACCTACCCAAGACAAGCCCATGCCGAGACTTGCAG
GCATGCACCAAAAGGTATGGGTCTGTGAGCGTCTAATACACGAGCGGCGCTATGGTCACATTACTGGTTATGATAATGCGCGGTCCACCTCCCGCTAATT
TTCAGAAATTTGCATTAGGTTGAAGCGCTAAAATGTGGTGCTCATGTTGCACTTTCAAACGTAAAACCACGCGTGACACCCAATCGAGGCGCGAACGCGT
TCGCGCGCGAGAATCGACCTACCACGCACGAAATCCGCAAAGCAATTTGATTGGCCGAAACCAAGTCGGCGGGATCTCGAAAGGTCGCCACGGTCGTATG
GCTTGAAACGGCACTTTCCCCCGAGGTTTTTCTTATCCCTGCAAAATCGGGATAACGGTCGCCGGTGGGTTAAGCTGTCCAGAATCAGTAGTTTGCATCC
GTCGACTGACGGCTTCCAAACCTATAGTGAAACCAAGTCAAATTAGTAAATGTCAACACACGTAGCATACCAAAACACGTACCCTTTCGATCCAGTCCAG
CATGACCGTGGCGTCGCAGTACGCGTTCGTCTGCACGGTATGCTCGACGGACGCCGCTCCAAAAGCAGGGTTGAACACCTCTTGGGATACGGGTCCGCCG
GGCACACCTGCAAAAACAACAAACGGAGGCAGCTCCTCGCCCGTGGCCGACGCAGCAAGGAACACGGACACTCGGAAGCCGTTTATCGCGCTTCCTACCG
GTACGTTCAAAATGTTAGCAAAGCGTCATAACGTACTGAAAATGACATCCTTACCTTGCACGACGTCGACCGTTTGAGCGCCCACAAAGTCAACCGTCCG
GTGGAGTGAAGCGCTGCGGCTACGGCTTCTGTGAAGCCACAATACGAACGTAATTATGCCATACGAGTACACCTCTCTCAACTTCGTGCTCAACGTTGCC
TTATCTCTTCGATGAGTTCGTCCACTGTGTCTGCTCACTAAGTACGGCCCAACACCACTAAGTTCGTTTCCATCCACTGTCCAACAAATTCGTACTACAT
ATGAAGTTGCATACTAAGTATTTCTATATAATGAAGCATTTCCTAGTCCTCTTCACTTTGAAGGAGTCGTATTAGAAGTTACTTGTCTCTGTTACGCTAA
ACTTTCCTGAGCTTATCTTAAAAAATATTCACTCAGATCACCAGACATTTGTTGAGGGGTTCTGTGGTACTATTGGCTCAATGTTCTCTGAAATTTATTT
CAGAGTTAAGGGACGATTGGAATCATTCACTGACCTGATTAATGGCTTAGCGCATTCCTGACCAAGTCGATCCATCAACTTTCATCGATAAACGAGGTTT
GTTTTTTACAAATATCATGCCAAACTGCAGTACAGTGGAGTAAAAGAATACACATACCCCGCGTAAGGTGATATTTTAGGTGAATGTTACCTGTGGCGGC
AGGTTGTGTGGAGCCCCCCCAAATAGCTACATTCGAGCGAGCTAAGTCGAAAATTTGCGTTTGCCGATCAGAATTTAACGATAGAAAAAATAGATTACCG
AGGTGGCTGCCTCTACTGTACAGTAATGTGCGTCAATAGGGACCTCTGATATGAATAGGAGTGTAAAGGCTATTAAGGCGAACAAGTGGAAAAAGAAATA
ACAATGTATTGATTTAGTCAAGAATAAATGACACACTGCTTTTACTAATGAGCGTGGAGTGCAACCAGCACTTCTGCATCGTAGAAGCTGACACATTATC
CCACGCAGACTCGCACCACTTCATGGCAGTTAGTAAGTCGACTGTATGTCTAGGGATGCCCAACTTCTTGGCTAGCACCGTAGCATAGAAGACGATCATT
GCACCGCTGAGGCAAATGCCCTCCGCCTCTGCAAGCATGATGAACTCGACGATGTTTTGATCGATCTGTAGCTGGAATGGAGACGGCTTGTTCTTGAGCT
GAGCACTTTCGTGAGGCTGGCGCAACAGCGCGATACGCCCCGAGATGATGCGGCCGATGGTGGCTTTCCCAGGGGGCCTTTGCGGACCGAACTCGACTTT
GGCCCAAAAGGCCAGGTCTTCATACTTGACAGCGGGGGAGCTCTCAGCCTTCTTGATCAGAAGCAGCTTCTGCTGCTGGGTGAGGCGAGTTCTAGTCTTG
GAGGAGGAGCTCATGAGGTGGGTGGATGGGTAGGGCGCTGGTGTTGTGGCAGATTCCGTTGTGCTTGGAGGAGGGAAGGAGTTATGTTCGCGCCCGAATT
CAAATGGTAACTTCAATCACTGATTGGCTAGATCTGACCTCACTAGCCAATCACGTAGTCGCGCTCGTTGCGAAACCAGCCAATAGCGCCAGGATCCTGT
CGAAAGTTAACTTAAATCAATGTTAGTTGTGTTCTTGACTGACAGCTGTATATAATGTATGTAAGGATATTAGTCGCACGGGGACCTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGTGACCGCCAGCGACACTGTGCAAATTGCCGCAGTTTTTTACCC
GCCGCAGTGGTTGACGGGGAGGCAGACTGTCCAGCGGACAAGTCGCTCTGGACACGCCACTGACGCCGGACACGTATGCGGAGTGGTAAGTCTCGACATA
CATTCACGGTGAACTGCTCAAAGAAGCGTCGTAGTGCCCCGTGCACGCGGTGGCACTACAAAATGATGTGGTGGGCTTCTTTCATGGATACAAAGGAATT
CCACGTGCAGGGGCGCGTGCCGGAGCAGTACTTGCCCGTCATGGCGTACTAAGTGGGAGCCTGTGGGGAACAAGTTTCTCACTCCCATCGCCATCATGCA
CTCACAATATTGCTGCTTTTGTCGCCCTTTATCATCTGCTCAGCGCTGCAGACACACGTGGACTCAGAGGCATCCATGTCGCTGGGGACAACGAGCTGAT
CCTGCGAGTACTTAAAACTCGAGCGCCACCAAAAGCAAGACGACTACAAATGTGGTTTCTTAAGTGCAGACGTACCGCGGACAGAGTGCGAGTCGCGTCA
TGGACACTCTTGAGCAAGTCGGGGAACGCTGCAGCGCGCACCCTGGCCTTGACAGTAACGGAGGAAGAGCTGACGCACGACCTCGAAACAGAGGCAATTC
AGGCAAGATTCCCACATATCGACACACTAGTGTCGCGATGTATGCTTGAGTGGGCTAACACGCACACAGATGCAACAGAGGCACTAATAGATCAACACCT
ACAAGGGAATAGTGGAGAGGAAGCGGCCGAGTGTTAAACCACGGAAGTAGGGTTGCTAGGACTCAATCCTCGTTAGGAGAAGTTGTCCAATATACCTCAT
CATCTCAAAAGTGCCCAGCGGAGGGATGCCGTACGATGAGTCCATTTCAGCTCATGACGGTACCAGTGATTTTCCCGAGGAGACCTCTGAGGATTGCGAG
TCGCAATTTGCGACAGCTGAGGGTGCGAACATGTTCTCCTCCTTCTCGTTTCGTTAGTTGGTAGCTCTCTATCTTCGTTAGCACTGTGAGTACGTGGTAG
TTGCTTGTGTAGCTTATTCCTGAGCGACAATAGCGGCATTGGCGCTGACAACAAGCGCCCCCAGGAGCAGGTAAACTGTCTGCATGTTGAATTGTGTAAT
CCGGCGTGTTTCCACTCTGAGAAGTGCTGTGAAGAGGATAGTATGTCCATTGTGATCAAGCTGGACAAGGTCATGGAGAGGAACCCGAATTTCGTGGAGA
AGCTGAGCGTGGATCTTGCAGCGATTGAAAAATTGGATAAGAACGCTGAAATTGCTGAAGTGTCGAGGAGAAGAACATTTCAACCTAACGTGCATCCCTT
TCCTCTTTTGCCTCACCAATTTTTTTTTTAAACCTGAAATTTCAGAGCTTCTTCGGGCCGGAGGCACACCCCACAATAATGCGCAATTAATCAATGAAAA
CAACGTCTCTCAACATTGAAAATAGGGTGGTGCTACAATCATAACATTGCTGTAAAGCGCAACGAGCTGAGCGGTACGCGGTTAAATCAATTTAAAGCAA
AAATAAAAGCTAAATACGCTGAAAGAAATATGCTTAGTCTGATTCGATAGATAAAGTATTGAATAGCCACGATAGCTAGATGATATATTAGACTGCATTT
CATCCAACTTTACCTGGCCAAACCTCGGCAGTAAGATCGGATCAAAATGTATAGGCTACCGCAGCGATCAAGTCGGTGGCGCAGTTGGCACGGAACGGCG
CAAGTAGGGACACGAGTTACTCCTAATGCTGCGGCTCCTGCTAACCAGTGGAGCTGCAGTTGCCGTCATTAAAGTTGTCGTTAAATGGGCATCTAGTTTG
TCGTTATAGTTCACTTGATTTCTGCCTGATCATCAGGATTCCGTTACGCACGGGGTACTATAATCTTACTTTGCGTTATCCGCAAGATTCATTGTCGCAG
TCATCACGTTGACTGCGACCAATACCGGTAGTACTGCTGATAGGCTATCTATCAGTGATAGCTGGGGCGAAAAGTATATTTTGTGGTACCATTATTATAA
TAACGTCGTAAGACTGTGTCAACGGAGCAGCAGGCGACGCCGCTCATTCGAAAGTTTGTTGTGAAATCTATTTTGTCAGCGCTGTGTTGCTTGCTGTGGA
CGGAACAGCCGTGAAGGTAGGAGCTTGTTGTCTCTTGAGGAGAGAGAATGGTGTTGAACATGGTACTTTGTTTGTTGTTTTACAGGCCCTACCTACCCTG
GTACAAAGCTTTCAAAAACTAGACTCGTTCGGGAGACAAGTCGCTCCAAGACCTTCATCAAGACGCACAAGAATAATGACGATAACCTGCTGCGTGCGTG
AGGTTTTACTTGCAGTATTGATCAAACCACAGTCGATCTATATTTCTTTTCATACCTCCACTTGCAAACCAAGGTTAGATGCCGTAGCTGTAGACCCAAC
GTAGCAAAAAATATCGCTATTCCTAGAAGCAGTTCTCGCACGTTTACCGGTACTGTTAATTGAGAAGGTGGTAGCTGTGCTGCATGTTAGAATTACCGAA
TTCCTGAGAACGCTTTTTTGTTTTTGTGTCTTTCTTGTCAGCTAACTAAACAGGTCAAACAATAACCCTTCGATGGAGATATAAGATACGTAAGTATCGG
GCGGTGCAGGAGGAATGCAGTACTCGTACTGGCGTTACGTGCCCGCTGATTATCTGCTCATTTGCCATAGTCAACTACCAAACTTCTATTGTGTTTTGTT
AGCCCTACCATTTTTCATGTGCCAGCAGTCCCCGTACTTGAACGTATAGCTCTGACACTCTGGCAATGTGACCCGCTAGATACCTTACTCTATTCGCGGC
GTGATTTATGGTGAAGTACTAATGCGAACTACCAAGCTATCCCAGCCTACGCAGAGCTCTAGTTTATTATTTTTTGCCATTAGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTAGTCAGTATGCAGTGACCTCACTTGCTATGGGCCAGGGCGCAGTGACTCTCACAAAGAAATGGG
TCAACTCGCAGTTTACCCGTAAACAGCAAATGTGAGTCAGCCCACGCCTCGAACAAACCAAACCAAACCAAACCAAACCAAACCAAATGGTTCGCAGAAT
GAGCAAAACCAAGTAACCGTTTGAACCAAGGTTCGTTGCGGCTACTTGGTTCTACGGTGTCGGGCGCCATTTTCAAACTAAAACGTACGGTTCGTCCGCG
CCACGATGGTTTAATTGGTTTCAAGGAACCAGTATACCGAGAGTTTCAGGTTCGAAATCGGTATTCTTTTATGAAACGTTCGAACCAAACCATTTGGTTG
GTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGTTCGAGCCTCGAATGGAGGCGTGGGTCGGCCCTTTTGGGTTCGCGTGTTG
CCCTTTTTGGGGCATTACCTACTGTCATCTGTTTACCCAAATGGAGGGCCTCATCTCATGCTAACAATGTTATGTGTTGGCCTAACATGTCCTAGACGAC
AGCAAATCTTTTGACTTCTTCCTGGATGTTGCAAGAAGTAATCGAGGATTAGAGACGCCTTAGAGACGCCTTCGGCACCCCCGTGAT