Description :
From Genome Similarity Track
Location :
Scaffold_725:779- 4350
Sequence
3571 bases(100 bases per row)
GAGTGGGAAGCGCTTCACCGCCTCGTGGCGGTGTCCGGAGACGCTGTCGTCGCATCGCTGCTGAGCTCAGCGACGCCCGACCAGCAACGTCTTGCAGCAC
AAGGGTTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGGGTGTCAACTCCCTCGCGTCCATCCCAGAATGACGTTGTCAAGATGTAGACGTCTACGTA
CTCTGGCGCCGGTGAAAACCGGCTTCCGCTAAACCGGTGGCTCCGCGAGATCGACATCGCTATCGCCTCACGACGCATCGAGGCGTTATCGGCCAAGATG
AACTTCCTCCTCTCCCGGTTAACCGGGAAGGCCAAAGAATGGGCCCTCGGGAAGCTGGTTGTCGACCCCGAGGCTTTCCCGACTCTGGAAACTCTCCAGA
GCGACTTGCGCCTCGCGTTCGAGCCCCCGCAAGATGAGTCTCGCGTTCGCGCAGAGTTCTTCGCTCTGCGGCAAGGGAAGATGTCCATGCGTGATTACGT
CCAGAAGACGCGACATCTGGCGTCATGCATCGTGACCAAGCCAATCGACATGGCCTCGCAAGTCCACGTATTTGTGTTTGGCATGCGCGAGGGCATGACC
CGCTACTGCCTCACCAGCGCTGAGCCCTCCTCTCTCGAGGAGGCGTTTGCACTCGCGATTCGCGAGGATTACATGGTAGCTGCATCGTACGCCGCAGCCA
TACCTGCGGAAGCCCGGGAGTCTACCCCCGAGCCCATGGAGATCGACGCCATCAACGCGTCGAGAAATCGACGTCGCGGGTCCTACCGCGGCAGCTCTGG
GCGAAGCAATCGCTCCCTCATTTGCTTCCGCTGTGGGAAGAAGGGTCATCGCGCGGCGGAGTGCCGCGCGCCAGCTCCCGCCGTCTCTCACGTCGACGCG
GAACACTCCTCGGTCGCTCATTCAAAAAACGACCAGGACCAGTAGGTGCGGGGCGCCCTACTGGCTTTAACGAAGGACCGGGCCCTCCGGTGGCAGCCCA
ACCTTCGAGCCCTCCCGTGCTCCAAGCACACACCAATGCCACCACTACGCCGGGCGACTCGAGACTGATCATTGTCAGCCTCCACGTCACCGGTGCCCGG
CGACCACTGCGCGCGCTCCTTGACTCAGGAGCGACCAACAACTTCTTTCGCGCGTCGTGTTTGTCGGTACTACCCAAGAACGTCCGCGTCCGGAATGGTC
CGGGCGAGATCCAAGTCAAACTCGCAGATGGTAAGGCTCGCCGCGTTGCGCGGCGTGACGTGTCTTTGTCGTACACGCTCGACGGCTTTCGTAGCAAGGA
CGACTTCTTGGTGATCGAGATGAACTACGCGTTTGACTGCATCCTGGGCATCCCTTGGCTTGCGCGATATCAGCCAGAGATTGACTGGCTGGCCCAATCA
GCCAAGCGTCGACGTGGATTCGACGTGAGCGAGGTCTTCACACACCTCTTGGTGGCGCCAAAAGACTGCCCCCACGTCACAGTCGTCGACAAAACAGCAA
CGACACAAGCAGTGCACAGAGCGAGCGATGGCCCTCTCTGCATGGCTTGTGCTACGTTGTTGAACGAAGAGCCCTCGCGGTTTCGCGAGGTAGATGATGA
GGTGGTTGAGCAGTGGCTCCCACAGTACAAGACGGTGGTCGAGCAGGGGCTCCCACAACACGAGATGATGGTCGAGCAGGGGCTCCCACAACACGAGACA
GTGGTCGAGCAGGGGCTCCCACACAACGAGACGGCGGTAGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGCCAGCAGCCCAAGCACCGAGGCAACCA
TCATCCGCAACAATTCGTCGCAGCCGCAGCTCATTCGCCCGCGTTGGGCCGGAACAAGCGGCAGAAAGAGCAAGAGCTCATCCCAGTGCGAGGGATGACA
TCGCCCAAGCGAAAGGCGAAGACCGAAGTGCCAACACGTGCGGAGAGCAAAGGACATTGGAGTGGCGATCCCTGAGTGCCGCCCAGCGTGGCAACAGTAA
CCAACAACAACAACTTCGAGCAACCCCGCCGCGCAGGATGATCGATGTGGTCTACTGTGAAGACAGCCAAGTCGGCTGCACCCGACTCAAGCTGAAGGAC
AAGAGCATGTACCTCGCGGTGCGTGACAACTTCAACTACAAGGACAAGGACAAGGACCAGGACATGGTGGAGTGGGTGTTGGATAGCGGCGCGCAGACCA
ACGTCTCGAGCGACCTTACCTTGTTTACGGAGCTACACGAAGACTCAGTTGCAGAGCTAGTCTTCGGCAACGGCACAACCGAGCGCGCAACTGTGGGCAC
AGTGCTGTATACAAGTGCTGAACGAGCACACGCGCAAGATCGAGGAGCGCCTCCTTGATGACGTGAGCTACGCCAAGTCGGCTGCCTACAACCTGATCTC
GCAGACCTACATGCAATTCAAAGGAAACTTCAAGGTGCGCATCTCGCATGATCAGAAGACTACGTGGCTGGTCAAGGACACATTGAAGCTGCGCTTCAAG
TACATCCGCGGGATGTACAATCACTAGGGGTGATCGCATGCAGGAAGGAAACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCACGGCCAAGCTTCG
ATCAGCTAAATATCTTCACGTTGTACGAGAATACAACGCGGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCGAAGGTCAGTCGGGTAATCTTGGCT
GAAACTCGCAAGTCGGAATTGGCATCGCTGAACCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACTCGGTAGATGTTTCGTCACGAGGAGCAGAGC
GTCAAGTACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAGCTCACCAAAGTGCGATTATGGTAATAT
AGCAGTGATGACTCGGCGACAGACGAAAGCCAAGAAACGCGTCAGGTTTGCAGATGAACACTCGGGGGATGTCTCAAAATCTCAAGAGGAGCATGAAGAA
CGACGAGAGACGTCCACCGAAGATTCATTCGGCGAAGATTTGCCAGACCATCCTCACAAGACTGTACCATCGGCATTTCCCGATGCGGAAGATGTTGATC
CGGTAGCGATACAGCGGGAACGACGCAGACGGATACTGGTGGCACAAGACGAGGAGCAGAAGTGGTTTAAC