Description :
From Genome Similarity Track
Location :
Scaffold_1737:779- 3863
Sequence
3084 bases(100 bases per row)
CCTACTCTTCTTCGTGAGACGCCGAATCGGTTCCGATTCGTACGATCCCGCAGGAAATCACAGCGTAATGCTCCACAGCTCAGATTTGCCTCGTCTACCC
AACTATGTTTGTCATATCCACGCCAATACACCAGAAATCCGCGGTAACTGCGTCCATATCTGGTTCGCTTCCCTGACCTCATGTCGGAGATCCGGATATT
CTTTGACCAACTTCAGCTTGGATACGTGTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCGTGTTCTCCAATCTTCTCGCT
CACCCGGAACGGTCCATGCCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCACTTGGATTTGA
TGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGACCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAGTATTTCTGGA
CTTGGTATCGCCATCGCCTTGGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATGGCCGCTTCCAGGGTGGATTTGGGATCCCACCCATGTACCAA
GTAAAATGATGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGG
ACATACATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCA
GGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCGCTAGCTCCAAATCATCGGAAAACGCACTCCTC
GTACGATTCAGCAATGGTTTGCGCAGTTCTAGACGTACTAGCTTTGGCTATCACGTATCCGGTAAACAAATCCACCCAAATCAACAATTCTGTGTTTCCT
TTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCC
TGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGT
CCGACCAATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACACCCCTGTTGTCATGGTGTTCTGGTAATCACCCCTCTCCATTCATT
CCCATCCCCGGTCCTCGCTGTAATTCTCTTTCTTAGGGGGGGCAATAAAAGAGACAAGTCATTCCAATCACTGCGTAAATCGTAGCGATAATACTGTAGG
ATTTGGTATCCTCCCGACTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAAGATCCACGCTTCCTCGTTCTATGCTTTGAGGATCCGCTC
AATGCGGACTCTCTTCACAAATGTTTCCTCGAGGATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTC
CCGGATCCAACTACCACCACTTCGTCTAGTCGGTTCAACGTAACGAGATCCTGATGCTCGGCCTCTCTCTCCACTTCAACACCACATTGATTCCGTAAAG
CGGCACTGGCCAAACTATCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCACGCAGGTGGATCATTACTTTCTGCCG
TAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATCACCAAATTTGAATCTCCCACAAATCACCAGCCTTTTTGGATCTTG
TCCTTTTGGTAGATCCAAACCCAGCAGGAGCCCGTTATACTCCGCTTCATTGATGGTGAGGCCCTCCGCATAAGTGGATCTGGCCCGCACAGCTTCCCAT
CCGGGCAGTCTCCACAGTATTGCGCTGTATGCTCCTCCTCCGCGTCGTACGCGAGCGGATCCATCGAAACTCAGGACGTACAGATCCTCATCCACTTGTT
TCGTCGGGATCGGGGTTTGGATCCGGCGTTTTGGGCTCTTTCTTATGAGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGTGTGATGCTCGCGG
CCAAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACGATCTCCAGTGTCCAAGGCGAGAGTAATGCTTCCCACTGTCCCAAACGTCCTTGTAA
CCCGGCCGACTTGAACAGCCAGGCTAGCGTAGCGTGTCGAGTCAGGATCCGGATGGGTCTTCCCACCAGCAGGTTGTAATTGAGATCCAACACGCGCAGG
AGCGCGAGTATCGCCTTCTCCACCGCTCCGTAGTTCAGTTCATTTGGCTTTAGCGTCCGGCTGACCAAGGTGACTTGGATGACAGATCCCTTCATGTTCT
TGTACCAAGGCTGCTGAGACTGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGGCGGAGGATGGGCGTAGTCGCGATCC
TGTTCCTTAGCTCCACGAATGCGTGTTGAGCTCGAATCCCACGGAGACCCCCCCTTTTTCGAAATTTAGTATGCGTTTTTTCTATCTCACAATAGAGATT
CCTCTTTTCCCCTTGGTCCCCCCGGGGAGGTACCCCACCCCCCTTTTTAAAATTTCTTTTTTGGGGGGTCTCCCCGGCGTGGTACCACTTGGATCCCTTC
GTGGATCCGATATCGCCAGGGCCAGAGCTTGATGGATTTTGATCCGGACAGCCGAAGTGGCCATCGCAGCAAAATCCACCTCCCTCAATTCATAGAGTAC
TGAAGCAAACAGTGCGTAATCCTCGATGAACCGACTGTAGTAGTTTAAACTGCCCAAGAAGAATTAGAAGGATTGCATCGCCCGTAACGACAGTGGGAAG
GACAAGTCTGCCAACGAAGACAGGTCCTTAAAATTCGCCTACAATCCCAACCTTGGAGACTCGATGACCTAAGTAATCCACCTT