Description :
From Genome Similarity Track
Location :
Scaffold_2268:779- 1891
Sequence
1112 bases(100 bases per row)
TGGNNNNNNNNNNCGTCTTCTAGAATGCGATTGACGCGTTCTGTCTGCCCGTCGGTCTCGGAATGGGCAGCCGTGGACATCTGGAGGTGTGTGTGCTGAG
CAACTTGAATAGCGAACACCAGAAGAGCGATGTGAACCGGGGGTCTCGGTCTGATACGAGGGTCTCCGGCAAGCCATGGAGACGGAAAACGCTGTCGAGA
AACACGGCCGCAGACTCCTCGGTGGTGATAGTCTGCTTCACCGCGGCGAGATGAACCATCTCGGAAAGACGAAAAACATGATACCATCGCGACCGCGGGA
GTCCTTCGGGAAACCGAAGCCAAAGTCGAGACTGTCGGAGTCCCAGACGTCCGCCGGGACTGGCAAGGAGCGCAAGCGGCGCCCGCAGAGCTGGGGCCGG
CTTCACGCGTTGGCAGGTCTCACACGAGCAAACCCATTTGCGCACCCAACGGNNNNNNNNNNAGAGCTGGAGCCGGCTTCACGCGGTGGAAGGTCTCACA
CGAGCGAACCCATTTGCGCACCCAACGGTATTGGTGCGGCCAGTAAAAGTCGCGCGAGAGTGAGAGGAAAGTCTTCTCGCGCGCGAGATGGGCAGCGACG
GGGGCATCGTGGTGTTCGTGGATCAGACGGAGCGGAGGTCTTCGTCGTTGGGCCACACGCGGCACATCACCTGAGTCGACGTGATAGTACAGTAGACCGC
CATCAAGGCGATAGCGGTAGACGCGAGACCGAATCTGAGGGGAGAGTCGGGCAAGCTTCGACTCAGACGGAGCCGACAAATACTCGATCAGCTCACGACA
TACCGGGTCCTCCTGATACGCACGCTGGATGTCTTCGTCGACTACACCGAGACTGTGACCGTGGTGATGCCCTCATCAGCACACCTTGNNNNNNNNNNTG
ACAGCGCGTCCGCCAGAGTGTTACTCTCTCCGGACTTATAGTGTACGACGAAGTTGTACTCGGCGGAGAATGGCAACCAATGGGTCATCCTCTGTGAGAG
GTGCGGCGTCTTGGTCGCCGTTCGCAGCGACGCATTGTCGGTGTATATGGCGAACTGCTGCTCCCCAAGCAAGTACACGCGGAACTTCACAAGCGCGTAC
TTNNNNNNNNNN