Description :
From Genome Similarity Track
Location :
contig_4:77898- 82724
Transcript NameFunction/comments
g1061.t1hypothetical protein
g1062.t1hypothetical protein

Sequence
4826 bases(100 bases per row)
CGGCGCCTACGCCGAGAGCTTCGCAAACGGCTACCTCTACGGCGTACACGACGACGACGGCGGCAAGCGCAATGACGACAACGACGCCTTCAGCGACGGC
AGGCACTACGGATGCAGCAGAACCTCCAGCGAGTAGCGGGCTTAGCCAACCTGTGTCGGCAACGATGGCGAACCCGGCGACGTCTGATACGACTGCCCAG
CTGCCAGTGGCGTCGACCCAAGCGGCAGGCGGCAGCCATTCGGCGACGAACCTACCAGACGGTGGTGCTCCAACCGCGACGACGAACTCGGAGATGATCA
CGTTGGTCAACGCCATCCACCTGATGATGTCGACTGTGGCGCGCTTGGAGGCGCACGTGGGCAACATGGAGCTCGCGAGGCCGACGGAAGTGACGCAGCC
TACCGTGGCAATGGCAGCACGGATGGCGAGTGAAGAAGCAGCGACACCAACTCCGCGGGCCACTGCGACGAACGAGATGGCGCGGGCGGAGACAGCGACT
CGTCGCACGATCCCGACAGCTCCGGCGGCGAGCAGTGTGGCGACGGCAGCACCAACGCGGCCCGTGGCACAGGAGCAACCCCGGCATGTGGCAGAACTAG
CGGAGACCATGGCCGGCAGAACAACAGCGACGGGGGCACGGACGACACGACGGCCGTCATTCCCCGGCGACGTGGACGACGGCACCGGCGGCGTTCGACA
CGCACCACGCGGCGTCAGCGGCGACGCAAGAACGCGAAGGATCTGGAGCTGACGACATACAAGCCCTCGCCCACGGTGTCTGTCTCGACGTGGATTGCGA
AAGTGGACCTAGCGGTGGAAGGCGCGCGCCTCTCCGGCCGAGGGGAATGGACGGATGCTGAGCTGTATTTCATAGTGGGCAACAAGCTGCAGGGCAACGC
AGCTGGTTGGTGGGTCCACATGGACCAAGAGCTTCCGAACGCGGAAAAGACCTAGACGAGGCTGAAGTCAGCGCTGATGCGGCGCTACGGTGAGCGTCCC
GACCAGGCCATGGCAGAGTGGCGGGTATACCAGCGCATGATGTACCCCGGAGAAACGTTTGCTGACTTCGCAGCTGGGCTCCGAGATCTGACGGGCCAGA
ACCACGTGAGCGAACGCACGTTGTTGTCGCAGTTTTACCGCAACCTGGACAAGACGACCCGCATGTTGGTGAGGCAAGACCCCGTGCCCACGACCCTGGA
ACAAGCGGTGGATAAGGCGACAGCCATAGACGACCCGAACGACAACGTGGCCCAAGGAATGATGAACATTGGGCAGGCGTGGGCAACCGCACCGAACGCC
TTTGCCGTGCCCATGAGGGGAACGACTGGAAGTGTAGCGATGGTACCTGGCGTAGGCGTGGGTGCTGGCCCGACGAGCGAATCCTTGGCGGCGCAGATGG
GCACCGAAAGCCAGGAGGTGGCGTTCTTCACCAATCCGCAGGGCGTCTACAACAAGTACACTGGCACGTGGGACGTGCCGGAAGGGCGATTCTGGAACGG
CCGGTACTGGCAACCGACGAAGAAGTACCAGCAGTCGAGGGCGCAGTATGAAGGACGATCCGGTGGCAAACGTGGCATGGCAGGCGGCGACAAGAGGGCG
AAGGTCCGTATGGTGCAAGCAGCCGAAGGCGAGTTTAGTGATGACTCAGCTGGGGAGGCATCACCACAGCTGCCGCAGCGAAAGAAGCAAAGACCCGGAG
GACGAAGGGCGCGATCCGCGTGACGAAAGCAGAGCCGCAAGACATGGACGCGGAGCAGAAGGCGAGCAGGTTGCCGAGCGCCGGTACGACGTGCTACGCT
TGTGGCGGCACGGGGCACTTCGCCAGAGAGTGTCCCGATCCAGAGGCGAGAGCGCGGAACGACGCGTATTTGGCGTCGCGTGCAGCTACGCAAGGGTCGG
CGGCGGAAAACGCAGACCGGGCGTAGTAAGGGGATCGCTACGTCCGGGAGATCAATGTATTCCCCAGCCGGCGGCGCCAAGTGGCATGAGGACGGTAATG
GTGACGGGTAGGCGACGAACGCAGCAGGGAGCTCCTCCGCGAGGACGGGCGCCAGGCGGCGGTGAGCAAGAACCCAGCGAGGTTGAGGAGGGAGACGAAC
AGTTGGTGCAGTCGGGCGGAGGCGCGGCGGCACACGACGAGGACGCAGTGGCTGTGGAAGCGGCAGCGAGTGCCCATTTGGACGAAGAACTGGCGGGACG
AGACGAGGAACGCGCCCATCGCTATGTGGTGACGGTGCGCCCCGCCATGGCGGTACTGCGCTACGTACGACCAGCGGCAGATGACGAGCGGCCTCGGCAG
GAAGAAGAACAGAGGCGAGTGACTGAGGAAAGCGACAGACTCCCGACGCGCAACGGAGGACTGGAGACTGAGGAAGGCGTCGACCTCGGAGCGAGAGGTG
GCATGCCTTGTGCTGTGGACGGCGGTGACCTCGAGACGCGTGATGGAGTGCCCGAGTCTGACCCCAGCAGTCGACGACGAGGTGTCGGCGGCAAGCAGCG
CAGAGTTGGCCGGCAAGGGCGACAGAAAAATGGTGGATGCACACAGCATCGCCAGAATGCGCAGGATTGCGAAACAGAAGAAGCGCGCAGCCAAGCGGCT
GCGAGCGGTGAACGCAGAGCGCCGAAAGCATGCAACCATGACGGACGCGACGGACGTGGACGCGGTGGTGACTGCGCTGGACAGCGAGCGACGGGCACGA
CGAGAACAACAGCGGAGTGAAGCGCGTGAAGTGCTCGCGCACCGGCGACAGCAACAAGAAGTCGTAAGGCTGCCGGCGGACGGGCAAGTGGCCAAGGTGC
GGCTTGTCCAACAGCGGAAGGTAACAAACGGCGAAACAGCGGCTGGCAACGACGTGTGCAGTGTGCTGGCTGAAGACGGTTTGCCGACGGCGACCATGGA
CGTGGAGGGCGAGCGATTGCCCGTGAAACTGGATAGCGGCGCCAGGTATTTGGTGGCTGGCACTGAATGGATGCTGCGGGGCGAACGAATGCGACGACCG
GCCCCTGTGGACGTGGTAGAAGGCATTGGCGGCTTCATGTTGGACGTCATTGGCGTGTGGACGTTCCACATGCGGAACGCCTACGGGCAGGCGGTGACCG
TGGAGGCGTGCATTATTGACGGATGCACGGACGAGTTCCTCGTCGGCGTGGACTTCCTCCAGCACCACAAGGCGACGATGGACTTCGAGAAGAATGAAGT
GCGGTATGATGAGCGACAGCAGCAAGTCGTTATCCCTTTCAGGACTGACACCAGTGACGGTGGCGCAAGAGTGGCGGCAGTGCGGCTGGTAAGTCGTGCG
AAGCTGATGCGTAGTGCGGTGACACCTGTTGAAGTGGCGGTTGCAGCCCCGGATGATGAAGACGGTGTCTTCTTGCCCACGATGACGTGCGGATCGGTCA
TGCTGGCAGCGACGGTGACGACCAGCCGGAACGGCAAGGCGATGGTCCCCATGATCAACGTGCAGGGCGGCAAGGCCAAGCTCCCTGGCAAGAAGGCGCT
CGGGTTCTGGATTACACTTGAGAAGGACATGCAAGTGCTAGCGTTGAATGGAGAGCTGGACCGCGACAACTTGGACGCGTGGCTGAAAGAGTTGGGCGAC
ACAGAAACGCCGCTAGACAACGAGGACGAGGTGCGAGTGGGCGAAGAGGAGCCCAACGCGCGAGCAATGGTGGTGCGCCTACTGCGAGCCTACCGTGATG
TGTCGAAGGACAAGGGCGACTGCCCACCTGTGACGGCCTTGGATGTGGAGCACCACATCGACACCGGTGATGCAGCGCCAATCATGCAAAAGCGGCGTCG
ACATGCACAAAAGGAAGAAGCAGTGATCGAAAGCAACGTGGGCAATATGTTGACCGCTGGCGTGATTGAGGAAGGCAGCGGAGCATGGGGATTTCCCGTG
GTATTAGTCAAGAAGAAGGATGGTGAAGTACGATTTTGTATCGACTATCGGGCTATCAACAAGATCACAAAGAGGGACGTGTATCCTCTCCCTCACATCG
ACGAAACGTTGGTGGCGTTGGGCGGTGCGCGATTGTTCACAACGCTGGATCTGCGCTCTGGGTATTGGCAAATTGGTATGGCTCCTGGCGATCGCGACAA
GACTGCGTTTACCACGAAGCAAGGACTCTATCGGTTTAAACGCATGCCATTTGGACTTATGAATGCACCTTCGACGTTCCAAAGGATGATGAACGGTGTT
TTACGTGGGTTGACCTGGCTCACGTGCCTTGTTTATCTGGACGACATTGTGGTGTTTACCCGTGGGGGAGTTGAACGGCATGTAGTTGAAGTTGCAACGG
TGTTGCAACGGCTCCGCGTGGCGGGCTTGACATTGAAGCTCAAGAAGTGCGTGTTTGCTACGACGTCGATGGAGTATCTAGGTCATGAACTGAGCGGTGA
AGGCGTACGACCGGTGCAACGTTTAGTGACGGCGGTGTCTGAATTCCCTCGGCCCCGAGACGCGGTCGAAGTGAAGAGGTTCGTGCACTTGGCCGGCTAC
TACAGGAAGTTCATCGAGGCCTTCGGCTCGATAATGGCCCCGATGACGCGTTTGCTGAAGAAGGAGCACGATTGGGAGTGGACGGAGGCGCAGGAGTTTG
CGTTCGAGCGCATCAAGGCGGCCTTGACGAACAAGCCTTTGCTCGTCTACCCGGACTTTGCTCTCCCTTTTCGCTTGGTAACGGACGCTAGTAAGACAGG
ACTGGGTGCTTGCCTGATGCAAGACCAGGGCCACGGCTGGCAACCGATTGCATATGCCAGCAAGGTCAACAGTAGTGCGGAGTCGAACTACTCGATCACT
GAGTTGGAGTGTCTCGCGGTGGTGTG