Description :
From Genome Similarity Track
Location :
Scaffold_38:77897- 79088
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011874Protein of unknown function

Sequence
1191 bases(100 bases per row)
TTCTAGTGTCGTGTTTATTGTGCCACCACGTCAAGGGTGGAAAGATCGTGCCAAGGCCATGGAGCCAGACATTGCGCTGCTACGAGCGGAATGGAGCTTC
ACATTGGGGCTTCGTGACACTTGGCAAGACGTTTGGTATGGACAAATGTCTTCTTGTGCTCAAAGACGAAGCGACTCATTTCTGTGAACTCATCCCGTCC
GCCACTCCCACGAGCATGGTCGCTGTCGATGGAATCCTTGGCTGGCATAGTCGGTACGGCATCCCACCGATTTGGATAAGTGACCAAGGAAGTCACTTTA
AAAACCAAGTTCTCACCGAGGTTTGCCGCCGCATGAAAAGTCGGCAACAGTTCACCATTGCTTACGCTCCGTGGACGAATGGCAGTATCGAGCGAGTGAA
TCGGGGCTTGATTCAAGTGCTTCGAGTACTCTGCCTCGAATACCAAGTGGATATCAAAGATTGGACATACTTCATCCCTATTGTTCAATAAAATTTGAAT
CACTCCCCAATACCATCTCTGGCGAATAAAGCGCCCATCGAACTGTTTTGCGCCCTACCAGCACAATCTCCGTTGAATTTCGTCGTCGATATCTCAAGCA
GAACGTACTAGAGTTGACGAAGGACTCGGCGCAAATCAACATGAAGCTTGCAAATCTGAAAGCAAGTTTGCACGACATGCACAAGGCGGTTGCTACACGG
CGCCACCACCAAACACAAAGGAGCATGAACGGTCAAAAGTATGTGCGTAAGCCTAACTTCGACGTTGGAGACTACGTCTCGCGGTCCCGAGTGGGCCAGA
AGGCCAACAATAAACTTCTAGTCACTTGGGTTGGACCTTACCAAGTCATACAAGCTGACGAGTATTCATTCGGGGTGAGGCACCTTGTATCGGGTGATGA
ACAAGATGTTCATGCATCGCGACTAAAATTCTACGCCGATCAGTCGCTTGAAGTGACAGAAGAAGTCCTCGAGCACGTTGCATCCCAAGGTATTGTAATG
GCCGTCGAGTCGATCAAGCAAAATCGTTGGTGTGATGCAAAGCGAGAGTTTGAGCTTTTGATCAATTGGAAAGGTTTCGAATCAATTGAAGACTCCTGGG
AGCCCATGCGGTCTCTGGTGCACGATATCCCGGTACTAGTACGGCGATACGCGGAGAGCATTGGTAATGCAAAGCTCTTACAATCCATTGT