Description :
From Genome Similarity Track
Location :
Scaffold_435:7787- 10502
Sequence
2715 bases(100 bases per row)
CTACTTTCCGGCCGCCTTCTTGGCCGCCTCGATGTATCGTTTCACATCGATATCCGGTCTGTTGATGATCTTGTTAATACTCGCAACGGGGGCTTTCCAT
ACCCCACCGTTCCCGTTCCCCCTGCCGCTCTGGACAACTTGTTGGCCTGCAAACCGAAGGGATCTTTTGGCCGCAGAATCAGGAGATACCTTCGACAAGA
GCGGAGAGTCGTCAGGATTCGAGGGCTCTGCGACGACGGTGCTGCAAGCTAAAGCCGCAAAGCCAAGAGCAACGTAGAATAGACTGCGCATGACTGTGGA
GGAGAGGGAGTCCGCTGGAAAGAAGGGTCTTGTGGTCTTGAAAGACAAACGTGGAATGACTGCCGACCATCGTAGGATAGTTGACGATGCCCCGCACTGT
ACTGTATCGTCAGACAAAAACTGAAGACTTGTCACAATGTTGACTCTGTGCAGCATCAACTCCCCAGCAGAAAATAGTATCACAGGTGGGTGTTCATAGC
CGCGGCGCCAACTGGGTGCGAGTACGTGCCAAAATCCGCGCGGTATTTGCGGAGGCGGGCCCAGCGCCGAGCTCACCAGCAAGCCGTGCATTACACTCTT
CACCCGCATGCACTCTCCAGGACATCGTATCTTCATATCGCGAGCATAAGGAATCACGGGGGTGCCGAAGGCGTCTCTAAGGCGTCTCTAATCCTCGATT
ACTTCTTGCAACATCCAGGAAGAAGTCAAAAGATTTGCTGTCGTCTAGGACATGTTAGGCCAACACATAACATTGTTAGCATGAGATGAGGCCCTCCATT
TGGGTAAACAGATGACAGTAGGTAATGCCCCAAAAAGGGCAACACGCGAACCCAAAAGGGCCGACCCACGCCTCGATTCGAGGCTCGAACAAACCAAACC
AAACCAAACCAAACCAAACCAAACCAAACCAAACCAAATGGTTTGGTTCGAACGTTTCATAAAAGAATACCGATTTCGAACCTGAAACTCTCGGTATACT
GGTTCCTTGAAACCAATTAAACCATCGTGGCGCGGACGAACCGTACGTTTTAGTTTGAAAATGGCGCCCGACACCGTAGAACCAAGTAGCCGCAACGAAC
CTTGGTTCAAAACGGTTACTTGGTTTTGCTCATTCTGCGAACCATTTGGTTTGGTTTGGTTTGGTTTGGTTTGGTTTGNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCACCGCCCGAT
ACTTACGTATCTTATATCTCCATCGAAGGGTTATTGTTTGACCTGTTTAGTTAGCTGACAAGAAAGACACAAAAACAAAAAAGCGTTCTCAGGAATTCGG
TAATTCTAACATGCAGCACAGCTACCACCTTCTCAATTAACAGTACCGGTAAACGTGCGAGAACTGCTTCTAGGAATAGCGATATTTTTTGCTACGTTGG
GTCTACAGCTACGGCATCTAACCTTGGTTTGCAAGTGGAGGTATGAAAAGAAATATAGATCGACTGTGGTTTGATCAATACTGCAAGTAAAACCTCACGC
ACGCAGCAGGTTATCGTCATTATTCTTGTGCGTCTTGATGAAGGTCTTGGAGCGACTTGTCTCCCGAACGAGTCTAGTTTTTGAAAGCTTTGTACCAGGG
TAGGTAGGGCCTGTAAAACAACAAACAAAGTAGCGCGCTTACACCATGTTCAACACCATTCTCTCTCCTCAAGAGACAACAAGCTCCTACCTTCACGGCT
GTTCCGTCCACAGCAAGCAACACAGCGCTGACAAAATAGATTTCACAACAAACTTTCGAATGAGCGGCGTCGCCTGCTGCTCCGTTGACACAGTCTTACG
ACGTTATTATAATAATGGTACCACAAAATATACTTTTCGCCCCAGCTATCACTGATAGATAGCCTATCAGCAGTACTACCGGTATTGGTCGCAGTCAACG
TGATGACTGCGACAATGAATCTTGCGGATAACGCAAAGTAAGATTATAGTACCCCGTGCGTAACGGAATCCTGATGATCAGGCAGAAATCAAGTGAACTA
TAACGACAAACTAGA