Description :
From Genome Similarity Track
Location :
contig_2:778650- 779708
Transcript NameFunction/comments
g624.t1hypothetical protein AM588_10011527
g625.t1hypothetical protein F442_06595

Sequence
1058 bases(100 bases per row)
GACCGGCGCTGGAGACGGGGGAAGGCGCAAAATACGCAGCAGAGGCAGCGGGTGCGTACCGAGGACACGGCGTCCGTCTTGGGGGCGTCTTCAGTGCTCA
TCGTGCTCACAAGCTTGCTGCTGCTGCTTGGCTCCAACGCGTGGCCTGTTCGGGAATGAGGCGAGTCGACGACTTTTGTTCGAGAACGATGACGTGTCAC
GAAACCTTTTTGCAATTAATTGCAAATTATATTCTGTCCAACACCGTAAATCGAATTTCAATATTATTGGGGAGCCATTCCACATTGTACTTCGACCAAA
CCTTCCGCCTCCGCCCAGATGAGCGTCTCCGGCATCGTGCGCCCGCGCTTCCTTTACTCGGGGGCGGGATCCACGCTGCAGTTCCCGCTGGACCTGACAT
CCACGCCCGCGTCTGAGCTTTCTGTCGATGTCTCAGCGCTCGAGGGCCGCCTGCAGGACGCGTATTTCGTGGCGCCGGCCTCGCACATCGGCCGCATCGT
GACCGGCGTCGTGTTCGTGGCCGAACAAAGCCGCGTGAGCCGCGCGTTTGCCGGTGCCACTGAGCGCTTCGGACTCACGACCATCTCGTTCGCGGACAAG
CTGGCGGAGCAGGGTTACAAGGTGCTGGTGTTGGATTTGTTTCAAGAGGGGAAGACAAACGACGGCACCACGCAAGAGCACATGGCCATTGTGCAGCAAG
CGGCACTGTATCTCAAGCTGAAGCACGACATTCAACGCGTGGGACTCTGCGGGGTGGGCGCGGGGGCCGATCTTGCCATTAAGGTGGCCGTGGAGCGCTC
GGCGCCGCTGGGCTGCGTCGTCGCCATGTGTCCGAAGGGACTCGTGGCCTGGAAACCTATTGGAGAACAGACAGAAGAGACGCCGATCATCCCGTTGCTG
CTGCAGCTGGGGGATAAGTCGCCCTACGCTGGATCTGAAGCAGTACGAGGAGGTTTTAAAAATCTTTTTGTGGTGTAACGAATGTTCGGCTAATGGGTGT
GTTGTGTGGCTGGTTGCTGCAGTACCAGACGCTGCTGAGCTCGTGCGCTGCAAACTCG