Description :
From Genome Similarity Track
Location :
Scaffold_45:77859- 82040
Transcript NameFunction/comments
g3253.t1POM61703.1 hypothetical protein PHPALM_29245 [Phytophthora palmivora var. palmivora
g3254.t1RAW41538.1 hypothetical protein PC110_g2265 [Phytophthora cactorum

Sequence
4181 bases(100 bases per row)
GTGAGCCGAAGAAGCGAATGGCATCCTGTGACATTGGTGTCATTGACACTGCGAAGGAAATTGGCCGTAATATTACGCATTTGGTCATCTATCTCGGTAA
AATACCGCAACCAATCGAAAAGATACAGCATACAAACGCCAAGTTATTCGACGCCCCCTCGCTTGCACGAAATCATTCCGGAAGACTAACGTGGGGACAC
TCCCCGAAGCAAAGAGCTCCCAACTGCAGGCCCCAGAGAAGCGAGCCACGATGGACCGCCTCGCGATCGACAAGCTTAAGAACGTCATGGACGAAGCGTA
CGTCCCCTCACCCCCCTCTCTCCCCTGCGAGTTATTGGCACAGTTCTGCTGACGTAGATCTTCCTTGTGCTCTCTATCTGTAGGAAGAGCGCCGTGAAGG
CCAAGATGGGAACCGACGTGGAGCGCAAGATGGAGGAGGCGCTGTCCAACAAGAACTGGGGCGCTTCCAGCACGCTGCTCAACGAGATCTCGCAGCTCAC
CTACGACTAGTGCGCAGCGTTCGATGTTCACAATTTGCTACTGTGCTGGTATACTCATGTAGTGTTGCTGCTCTTGAATTGTAGCGAGGCGTACGGCGTC
GTCATGCGCAAGATCTGGGAGGCGCTGGACGCCGAGGGACGCCAGTGGCGTGCCGTGTACAAGGCGCTGAGTCTGCTGGAGCACCTGATCAAGAACGGCA
CGGAGCGCGTGATCGAGAACGCACGCGACCACATGTTCAAGCTGCGCCACCTCTCGGGCTTCTCGTACCACGATGGAGCTGTGGACAGGGGCAATGGAGG
TGGGAACCTTAAGATTTTGGGCTGCAAGAGCCTAGAGTTGCTGACTTTTTTGTTGCAGTCCGGGACAAGGCCAAGCAGTTGGTGGACATGCTGAACGACA
ACGAGATGATCCGCACGGAGCGCGAGAAGGCGGGACGTCTTCGCAACAAGTATGTAGGCATTGGAAGCGGCGTTGGCGGTGGAATGGGCGGCGGCTATAG
TGGCAGTAACAGCTACAGCGGAGGAGGTGGCGGTGGCTACAGTGGAGGAGGTGGCTACAGTGGTGGTGGTGGTAGCGGCGGTGGTAGCAACAGCTACAGT
GGTGGTGGTGGTGGCGGCGGCGGTAGCAACAGCTACAGTGGCGGCGGTGGCAGTAGCTACAGTGGTGGTGGCAGCACGAGCTACAGCGGCGGTGGTGGTG
GTTACAGTGGCGGTGGCAGCAGAGGCTACGGCGACAATGACTCGAAAAACTACCAGGAGAAGGAGAAGGGCTACTCGAGCCGCTACGCTGATGACGACCG
CGGTGAGTAGCCACAAAAATGACGCTATTGAATGAACCACTAACGTAGAACTCTCTTCCTAACAGATGACGGAAGCGAAGAATCTGAATCGGAGGAGGAA
GTGCGCTCCAAGCGACGGACAGCGTCATCTAAGCGTAAGGCTGCGGCGAAGAAGAAAGAGGTACTCGGGAGTGCATTTCTTGTTGGGTTGTGTAATTTAT
ACCAAACCTAAACTGGTCGATTTTGAATTTACAGGAAACCGAAGCCAAGCCAGCTACGAAGACACCCTCCGCGCAGCCGTCCCTCCTCGACAGTGACTTC
TTCAGTGCTGCTCCCGCGGCAGGTATGAAATGCTTTATTTTGTACTGATGATGGCAGCTTGATTCGGTTTACTAAAACATTGCTATAGCTTCTCCTGCAG
TGAATACATTTGACCCCTTCGCACCAGCACCTGCGGCCCCCGCGGCTGCACCTCAAGCGGCTTCATTTGCGGCGTTTGGAAACGCTGCGACCGCACCTCA
GCAGTCGTTTAATGCTTTCGGTACGCCGCAGCCGCAGCAACAGCAAGCTTCGTTTGATGCTTTCGGAAACGCTACACCAGCCCAAGGCAACGCTCAACAG
TTCGCTGCATTCCCCGCTGCGCCAGCTCAGCACGGCTTCAATGCCTTCGGCCAGCAAGGTAACGCCGCTGCTCCTCCCGCTCCTGCTTTCAACCAGCAAC
AGCAGTTTGGCCAGTTCGGTGGCATGCAAGGAGGCATGCAGCAGCCTATGCAGGGTGGTATGCAGAGTGGTATGGGCATGCAGGGTGCTCAAAGCCGAAC
GTCTTCCAATCCTGGTGCCAACCAGGCACGAACGAACTCGGGTCCGAAGCCGGATGAAAAGAAGAACAACGATGCGTGGGGTGCTGGCTCGTCGCTATTT
GATCTCAACAATTTGTCCAGTTCTACCGGAAGCAACGCAAGTAATGCAGGCCGTCCTGGTCAGCAGCAACAGCAGCAGCAGCAGCATCAGTCCAATGCGG
GCCGCAACAGCTTCAGTGGCCTGGACACTCTTGCTGGGATGCCCAGCAAGCCGATGGGCGGTGGCGGTGGCATGAACCCTATGGGCATGGGTGGAATGAA
CTACGGCGGCGGCATGGGCCAGGGTGGCATGCAGCAGCCCGGAGGCATGGCGTACGGACAAATGCAGATGGGTGCCATGGGCGGAATGCAGCCCCGCCCC
ATGATGGGGGGTATGGGCATGCAGCAGCCAGGCATGGGTATGCAGCAGCCTGGCATGGGAGGCATGATGAACCAGGGTGGTTTTGGCGGCATGAATGTGA
TGCAGCAGCAGCAACAACAGCAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGCAACGACAGCAGCAGCAGGCGTTCGGCTCATTTGGCAACTTTAGCTG
AAGAGAACTGGTTGGCGCTACAGTCTCGACGCAAGAAGACGAGCAGGTGTCAAGTTTGCCGATAATACATGGTAAACACGGGTGTGGCAAGTTGATGCCT
ACCGTCCAAACAACTAGACGAAGAGACTTCAACTGCTAAGAAGAAGCCGCAGTCGCTTCTGCAGAATGGATGATATACGTGTGCGAGAGCTGCAGCGTCA
ACAGTCCGAGCATGTTGTTTGCCACTTTTTCGTGCGCTTTGAGTTGTATCCAAAACGCCTCAATTGAAAGCCTTCTCACCACTGCAGTGACTGATGACAC
GATGCAGCGGTGAGAGGTGGTAATGGAGGAGACATGTATGCACACTTGCACTAGCACTAACAGCTCCCTCCTCATGTCTTCCTCAAAAAGATGCAACACT
CGATAGCATCTTTGTCGAACTCTGCGAGCCGCGCGAACTACCGCATTCGTCAGCGGTAAAATCTTGTCGCTGTACCTCCAGCAACAACAGCCTGGGAGGA
AGTGACGCATTCCAGCTACTCGCCACACTGTACGTTGTCCAGCTCGCTCAGCGTCGTTAGCTACATAGCCAGCTGGGCCAGTATCTAGTCGAAAAAGAAG
TTCCTTTGCTCCTTCAAGAACACGCCGAAAGTCGCCCATGCTTGTTTCCAAACAGTGCGTTCTGCGGGGACTGCGGCTGCGTCGTACAAGCGTCCTCCAT
CTCCTGGTCCTGCTCGAGTCTCTGTCTAGCTGCGAATGTCTGGAACAAATCTCCACTGGCACTACTACTCCGTGACAATTTGCCCGAGGACGTGGCCAAG
ATGTTGATCTGACTCGACGTTTTCTTGAGACTCACGCGCTGCTCGTCTCCGTCCTCTGCTGTGTCCACGTGGACCGATTTCCGTTTCCTCAGTCCTTCCG
GGTACTTGTTGAGCACACTAAAAGGCGACATGACGCGTAAATGTCCAGGTATCGACAGTCTAGCGGGAGGACTTCGTTTCTGGCCTCTGGCGAACGCACT
TGGAGGCGGAGAGTGGACGGCATTGTCCTCCTCCATGGGCGTGATCTCCACCTCGTCCACACTCACCATGGTCTCGAGTCCTCCGTCGTCGTCCTCGGAA
CTGGCTCTTCTCTGTATCCTGGTGCTCGCCGCCTGCTGCTTGCGCCTCAGCTGCTTCCTCAACACGTCGCGTGGTTGCGGAGACGACGGCGGCGTGCTCG
GGCGCTCGGGCGGGAGCAGCTGCAGCACCTTAAAGTGTTCGTTGGTGGCTCCACTGCTGCGTCTGTCGGCCTCCGCCTCCTCCGCGGCGGCTGTCGTCGT
ATCGTGGTGACGCCCCACGGCGATGCGCGTGAGCTTCTCGCGCAGTAAGACCATGTCTTCGTGGTCGCTGACGAGCGAGTTGCGTCGCAACTTGGAGTTG
ATGTTCACGGCGGCGTCGGGCGTCAGCGCGCGGCTCTTGGGGCACAGGTTGGGGCTGGACGGAGACATCATGGCGGGGAGA