Description :
From Genome Similarity Track
Location :
Scaffold_47:77858- 79187
Transcript NameFunction/comments
Phyke_g2411hypothetical protein

Sequence
1329 bases(100 bases per row)
GGCTATCGGATATGATACCAATGCTCTATATCTATGGGCATTAGGAAACGAAATGCCCTGTGGTAGACTGACAACGATCGAGGCTTACCCAGGTATCATT
GATGACATTAATGCTAACAAGATGTTTGGATTTCTTGCGTGTGACATTAGAACCCCAGAACACCTGAAAGAGTATTTCAGCGAGATGACGCCAATCTTCA
AAAATATTCTAATTGACTGTACAGATGAGAATATCATTGGTAAGCATATGTATGAATATAACGAGTCACGCAAGCAGAGTCGTTCTAAACCCGCTCGTAA
GTTGATCGGTAGCTACTTTGGCGAGAAGATTCTAATCTACACACCCCTTCTTAAGTGGTATCTATCGCATGGTATGGAGATCACAAAGACATACAGCTTC
GTCAAGGCAAATTCTCACAATGTATTTGCCTCATTTATGGAGGCTGTGTCCAATgcacgacgagaaggagatgtTGATAAGTTTAAGCCTATGATTGCTG
AAATGATGAAACTTGTTGGAAACAGCGCTTTCGGTCGATCTGGCATGGATATGAGCAAGCATAAAGAGGTAAAATACGAGTCAGAAGAGAAGGTTATTGA
GTCCAAGATTGAACACTTCACGTTCCATGGTTTGGAGGAGCTTAATGACGCATGTGAAATCACAATGAAGAAGCGTCGACTCAAAAACAAAAATCCTATT
CATCTGTCTATCGCGATTTATCAGCTGGCGAAATTACGCATGCTTCAGTTTTACTACGACTGTATCGACTTCTATTTTGACCGATCTGACTTTCAATATC
AGGAGATGGACACCAACTCAGCTTATATTGCGTTCAGCTGTGAAAAACCATTCCAGGACTGTATCAAACCAAGTCTACGCGagcacttcgagcagcaCAA
GTACGATTGGTTCCCACGCGACTACAACAATGAGGTAGCCAAGTTTGACAGACGAACCCCAGGATTGTTCAAGGACGAGTGGTCCGGTGATACTATGGTA
TCATTATCGTCCAAGAACTATATCTGTTACCTGCCAGACTCTAAGTACAAGGTCAAGGTTTCAGCTAAGGGTGTGCAGCAAGGTCGTGGAAGAAACGTTG
ATGTTCTAAATCCCAAAGGATTTGAGACAGTTGTTCGCGATAGAATTACACTTCAGGGTACGAATAAGGGGTTTCGTATCAGTAAAGAGGCCAAGTCGAT
CATTACCTACAGTCAGACGAAATGCGCTCTTTCCTATTTCTATGATAAGCGTCGTGTCTTAGCTGATGGTATCACGTCTTTGCCGCTTAATATATAATTC
ATGAGATTTTAACCATAACATTATATATA