Description :
From Genome Similarity Track
Location :
Scaffold_130:77847- 79715
Transcript NameFunction/comments
g10241.t1hypothetical protein

Sequence
1868 bases(100 bases per row)
CGGCTGCAAGCGCGTGAAGTGGGGCGAGTTGTCGAACGAAATTTGCGGGAACGAGACGTCGACTTGTTGGCCGCCGCGCTTGGAAAAGCCGGGAGTTAAG
GCAGGGTTGCCGAGGTATTCCCCGAACAGTTTGGCTGGTGTGGGCGGAAGCTGTCGAGGTGAGGCGAATTCACCTTCGAGCAGGAGCTCACGAAGAATAT
CGTTGTCTTCGGAGACTGCAGCTGGCGTTCGTCGGTCTGTTTCAACGAAACCATTTGCGAAGAACATCTTGGGACACTGGCGGTGAAGGAAGGAGTAGTG
AGCGGAGTTGAGTCGAGTGGCCTGCTACGTGTTGAAGTGGGCACTTCAACAAACGTTTAGGTGGAATACAGCAAGCTGAAGAGGCGTGACTGTGGGGAAA
GCTTCGCCGTCGAGACGGGAAGTTGAAAAGTGATCTCTACTCCGCAATCGACGGGCGAGGCGCTACGTGCCGAGGTCGGAACGTAGAACTGCCAGGCGGT
ATCACAACCGGTCACCGCGCGTCAAGGCAGCTGTGCAAAACGACCCGCGCGTTTCCGAAACGACCTCTTTGGTTAAAGCGCTGGTTGGCTTTGACGGCCA
GACTGTTCCGCGAAGACCAGGAGTTGCCACACAGAGCCTCGCAGACCATGCCTTTCGTCGTTTGCCGTTGGCGAGCACGCCGTTGACCTCCTATTAATAC
CGTTGCCTGCAACGGATTCATCCGTTTTGAGCCAGATGCTCAACGCCACGTCAGGCCGTTGAGTGCTGGAACCGTTACCCCACAAAATGCAAAACGGATA
CCAAGGCTCGAGTAGCGGTCCACGCAACTGAGCCGCGGCGCGAAAACGAGCGGAGACAGCAAGCACGAGCGATCCAAGCAGTGCTGCAGCGGTTTTCTGA
TTGCGGCGGATCACCAAACTTGTCTCGGGCCCGCTGGAATGCAAAACCAACACGAACGGATCCGGATCAATTGACAATTTCTGAACAGCGAATTCAACAC
TCGCGCAAGGATACGGCAAAGTGACGAGACGTTGCCTCTCAGTTGGATGCATTTCCTTCGTCATTTCAAGCGCGGCCTGACGAATCTTTCGCTGCTCGAA
TCAAACTGAGCTGGTTTAGTGTGATTGGGACCTTGCACACCGGGCAGGATGTGAATCCATCTTTCTCCATCTGCATGAATCAATTACGAGGTAGCACACG
AAAATAATCAGTTCACTCCAACTTCCCAGCACCACGAGTCCCGTACATCCCATAGATCTATCGATGATTACCTTTTTCCAGCAAGAATGACAGCAAATAT
GGCCGCACTGAGGGGAGGCATACGCCTTGCGCGTAATGTCGTAGCACACGAAGCACTGTGGGTCCTTCACGACAGCTGCCGTTGGAACGTGTCCGTGCTG
GGTCTTTTTTCTCTTGTGCTGAAGACGTTCGAAGAACGTCGACATATCCGTAGCCCGCGCTTGAGCAGAGCTGGTCTCTGCATCACCACTAGGCGAAATA
TGCAGCCCATGGCTCTTGGCTGCTCTGATAAACCGATCGCACATTGCACCGTTCAATACCTTCGGCATCAGGTCTAGCAGCTCTCTGCAGCCCGGGTCTC
GAAGGAGATCACAGATCCCACCCAGAGCTGCGTCGACGTCTTCCCCTGCGTGAAGTTGTCGAATAAAACCATAGAGTTTGGGTACGTCTGATGGCTGGAG
CACTTTCCTTGCCACGGTAGGAAACTCGGCCGCAAAAACTTTCTCGCCACCTCTATCTCCTTTCGGAATACCAGTGCTGGGCCCTTGTTTGGCGGTGAAC
TGCTGCTTCGCACTTTGCCACGACTGGGCGTCTTCATCATCGAGAACAATCGCGCTGGAAGCAGTGCC