Description :
From Genome Similarity Track
Location :
Scaffold_34:7784- 9839
Transcript NameFunction/comments
Phyta_totarag1687hypothetical protein

Sequence
2055 bases(100 bases per row)
TCAGCGTGCGTAGGAATCGTGTTCGCTGTGCGTCTGGTATAGTCTCCATCACGCCGCATAACGTGATGCGGTCGAACTTGGATGCGCGGAAGACGCTCAA
AATTGTTAGCAGCTTTTCTGGCGTCTCAGCGAGCACGAATTCCATTTGATCGAAGACCTCAAGTTCACGGGCAAACTTCTTTGCGCGCGCGAATTCTTGG
ACTGACGACAATACGCACACAACGGTAGCGTCGGGGTGCTGTTGAGCGAGGTAACAGCCCACCCCTCCCCATGAGCCGATGCTAATGTCCAAGACGGTGT
GGCCAGTCTGAAGCAAGATAGACGAAAAATGTGAAATGTCACTACTTCCAGACCAACGGCGAAGGTAGGCGGCAACGTTGTTTGATCAGGCACCTACCCG
aatgtccagcagctggtccAAATTAGCAAGCTTGTTGGTCTGCGCAACATTGATGGCTGTTGTCCCTGCAGTCCAAATGCCGAAGCCTTGATGGAAGTAT
CGGTCCATATACACTTGTCGAAACTCCGGACAGAGGTCAAACTGCTCCGAGACGGCACCGACAACAAGACCCATAGACGACGGTGGGTAATTGAACAATC
GTGCTGCCAGCGCCACAAAACGAGCGCTCCAGGATCGGTACATATCCTGTCTGCCTTCCATCGGAATGGTAAGCAGACTAGCAACCACCTCGTCTAGTGT
ACGGGCGGAGTTAGTCGCCCACAGGCAACCGACATAGGATTCGCCAATAGCCACGAGCCCCTCGCTCATCCAATCCAGCCAAAAGGAGTCGTCTCGGACG
ATAAAGTCCTGGGAAGGCAATAAACACCAAATATGTTTTTGATACGCTGTCAGGTTCCAGCCAACAGCGATCGAAGCCATGCCAAACACCTACCACATTT
GGTCGGATGCCGCCACTAGACAGCAGGCGACACATAATTGTCTTGGCATTCTTCCGCAATTTGGGTAGAGACAGCGAGCGGATCAACTGAAGGCAAAACA
AAATTGCCCCCGCGATCGCCGTCGCGACATACACCCAAAAGGATCTCTGCCACACACCAGCGTCAACACCAAACAACGCCCAGCGAGGACGAACATGATA
TTAGAAAGGACTTTAGGCACGTCCACCCAGCGACCAGTAGACTGGCTGAGCAGACAACGTGGGCATTCCGTTTCAATTTACTACCTGGTGTGCCAGGACA
CAGAAGAGCGGGACGAGCAGATTCAGCATGAGCTCCATCTTGTAAGCTGCATTCCAAAAGTGCTGCGAGCGCGGCGGCGAGAAGCGATAGACGTGGTCTG
CCTTCGGGAAGACTCCACCTCCCACCACAAAATGGCTCCACAGTCGCGACGATCTGCTCACATCACACCACACCAGAAAACAAAACAATCTAATCAACAT
GGTGCTGAGTTCCACGTCTTAgacagcacacacacacaccccTTACATTAAAGCCGGCACGCTCATCCACACGCGGACAAGCGGCAGGTAGCACGAGatc
agcagcatcggcaccagcaagtgcagcacgaaGTCGCCGACACGAGCTGCGACGCCGAGCACTGGCGAACTGGCCCAGACCCCGAGCCAGCCGTTGAGGA
TGGCCGTGAAGGCGTAGCGGTCGAACACTCGCAGCGAGTACCAGCCCACCATGATGGTGATGCCCATGGACGTGGCGATACCCAGCGCCGCCTCGGACGC
CAGCACATGAGCGATTACAGTGAAGACGAACCAGCAGTTGGTGTACATGGTGCGGATGCCCACGAGTGGAGGCAGCACAACGAcgccgaacagcagcgcc
acagcCAAAACAGCGTCCACTTGGTCATCTGTTTGGACGGCATCGTGGCTGGCGCGGCCCAGCGTCCCCCACCCCAGAAGCGTGTCCATTTTCGCCTCGA
TCGACAGTCGAAAGTGAGCTGAGGTTTCTGACAACAGTTTGGTGATCCGTCGATATCTTAAGGTTTACTTGAGTTTATTATGACTATTTAGGATATCAAG
TGAGCCGTGTTGCTCCAGCATCACGACGACTGTCATGAGGACGGCGTGGTCTTTT