Description :
From Genome Similarity Track
Location :
Scaffold_58:7784- 9285
Sequence
1501 bases(100 bases per row)
ATTTTAGTCAATCAGGGACACCGTCGCTCCGCTCGGCAGCCAATGGGAGAGCCCAAAGACCTTACCGTTTCGTGTGACGGACGGACACCGTGCTAGCGTT
GATATTTAAGACTAGCCGAGTGCCACCGCTTCGCGGCGGTGGTGGCAGGTTTTAGTCCCAGTTATTTGAGCCGTCCGCCTCCGCTTCGCTCCGGCGGACT
ACGGATTCTCTTATGAAATTTAGCTGTAGTGGAATCAATACAGTTCTGGTAACAAAAAGAAGAAGGTTTGAACATAGAAACACATGTTTTAATATGTATG
TGAGGATACCACTCCGAACCGAAGATCTGTCTGTAGACGATGTTCTTCGTGTAGACCCCGTCCTCGTCCTCCACCTCTGGGTACTCGATCAGTGCCCGGA
ATCTTGATCTTGAAGTTACCCGCGACATCGCGACGTACAGCTGTCCGTGAACGCTGGCTGGATGGGAAACTGCTTACGCCTGAGTTGAAATGGAAATTTC
CGAATGTCTTCGTCGCTGATAAACTCGATGCGGGGGATCAAGATATGTTGTCCTTGTCGCTCACCTGTCATGATCGTGGCGTGAATTACATGAGGCTTGA
GGGCAACGATCCGTAGGCGTGTTCCGGTGCACAACCCAGATCTGGGTTTAAGTTCCACATCAGCATGATAGGCATTCCTACTTTGAGTGTAAGCTTGTGC
GGTGGAATACCACTAATGTTCATCGAGTCGAGTACCTCTTGCTCGAAGAAATTGCCATCGCCATCATCGTGTACAGAATCCGAAGACATGTATTCTCGCG
CCTGTCCCGATAAACGATCAGCCACCGCTTCGTTGATGCGATGCACGATCGTGTTCGTGGTCGTGAGGATCGTGCGGTTTGCAAAGTACTCGTCGGTCGC
AATCTCGGGATTGTGGCGTACATGTCATCGATGATCTGATTCATGCCTCTCGGAATAATGCCAGGACGGATTCCTTCATCATCGCCCGCTGGTGGGTTAT
CAATCAGCATATCGCGCGGAATTTTCATGTAATCTCCACCTAGAGTTGTATTCACGTCATGTCGTCCCTCCCTATCTTGCAGCAGGAAGTCGGAGAACGC
CGTCATTTCTTCAGCAGTGTCCGCGGTCTCCGCTGTACGCACACGCATAAGCGTCATTCTCCGTGAGATGAAGCGTCCGGAAGGGGGGCCACAACGCCGA
TGATTTTAGGCAAGTGTCGATAGTTTCGACAGGTGTCCCATTCTTCACGACAGGGAGAATTTGGCGGAAATCTCCCGACAGCACGAAAACTTTTCCACCA
AAAGGTTCAGCATCGTTTTCAAGTAGATCTCTTAGAGTTCGATCCGCCGCCTCGAACGCATGCCGATGGGCCATTGGGGCTTCGTCCCAAATAACCAAAC
TTGCTGCTTTGATCAGCTCCTTAAATGGGAGCTCTTATTGATAGAGCACGATGAGCTCTCATTCAATCTCAAAGGGATCTTGAATGCCGAATGAGCTGTT
C