Description :
From Genome Similarity Track
Location :
Scaffold_11:778294- 779398
Sequence
1104 bases(100 bases per row)
GCCTCGCCAGTCGATCCAGGGCTCGTGCTTGTCAAGCCAGGGCATGCCCAGGATCATATCATATGGATCCATATCGAGAACAGTGAGCTGTTCGAGGCTG
TCAACGTCTTCAAACTTGACGGCCAGATCCACTTGGACGTAGGGAACAGTGACGACCTTCCCGTCGGCCAGTCGCACTGACACCGTCCCGTTGCTCTTGC
TTTCTCTCAAAGCATCGGACAACTTGTTGCTGTTGCGAGCAACCGTCTGGCGGCGTGCAAAATTCTTCGACGCCCCAGAGTCGATCAAGATTCTATAGGG
ATGATCGAACCCCCGTACACATCCGTGTACTACAAGCAACCCGCCGCTGCTCTTCGCCGATTCGAGAGTGCGAAGACTTTCAGGGGCTATGTTCCCGTGG
TACGCGCCACTCGCGCACCCATCACGAAGACTTAGATCTTCCCCAGTAGGGCGCCCCGCCCCTACTGGTTTCCGGCATTCCCCTGTCCCCGGGGTCCTGG
CTTCTGCCAGCAACCCTTGAGGACGGGCTTGGGAAAAGACCGTCTACGGAGTCTTTCCGCGGGACAGTCGCGCTTGAAGTGGCCCTTCTTCCCACAGCCG
AAGCAGCGGACGTCACGCTGTTCGGCGGACCCGAGTCCATGGAAACAGGTCCGTTGGGATCGTTCGACCAGGAGTTGACATGGAATTCCCAGGCCACGCT
GCGGCCGGCGTACGCGCCTGGCGATGGTTGACCTCTTCTTGGAGAGCCACTTGAATCGCCTCTTCAAGGGTGTTTGACTGCACCCGGAACAGCTGAGTGC
GTGCGGGGTCCACTCGAAGGCCGTCCATGAACACAGCCATCTTGATGTGTTCGTTGAGTGGGTTTCCCACTAGGGACGCCGTGAGCTCCCGTATCTCTTG
CACGTACTCGTGCAGTTCACGCCTCCCTTGTTTGCACGAGAAGAAGCGCGAACGCTGGCGGTACTCGTAATTCGCCGGGAGGAACGCGGCTCAGGGCTGT
TCACACAGCTAAACCCAAGATGTGAAACATCCAGCGGATGTTGCTTCCCGTGTGTACACCCAACGCTTAGCACGGCCGCTAAGGTTGGAGAGTGCAAAAG
CAAC