Description :
From Genome Similarity Track
Location :
Scaffold_1:778229- 779416
Sequence
1187 bases(100 bases per row)
ACACAGGTGCGGGTTTCTGTGGTCGATAGGATAGGTACGCTTGTAGAGTGCAACTCGATGTGTCTCGCAGTAATCCGTTTTCTGGGTGGCATCCCTGCCC
TCGAATTTACAAACAGTCCGTTTGTGCATTGCCCGACTCCTTCCTTGTAACACAAGCCACGATTCGTTTGCTACACATGTATGTGCTGGCGTTTCTAACT
CATTCGTATTTCTGGTCAAATTGGCAGCAGTGGTCATGGGTTTTGTGTTCGAAGTGTACACAATTACGTCATCACTGTCAATGGACTTCTTCCAATCTCC
ATTGAATAATTCTCGCACAAGTGGAATGACAAACGCCCGGTGACCGTCACGGGCGCTTGCCCTTGCATTATTGCGAGGCTGTGCAACATCCATCTCGCTT
GTATCACGTGCCAAGTTATCGCATACATACGCATTACATCTCGCGATATCAATCATAGCCATTGCTAATTTTTTATGCCACTTCTGAAATGAGTGACCAT
CGGCAAGCGAAATCCGACCGCGAAGCTGATCATGACGGTTGACTCCCTGCATCCCCGCGTTGTATTCACCGAGGCAGGCCGGGACGTTAAACGCAACATG
TTCCTCCTTTATGCGACGATATACCGTAGAGGAAGAGTAGGCGTCAACATTAGAGACTGTATTCACAATAGAGCCATCTATCCAACTGGCCGCTACGATA
TGTTACTCTAAGCACACGCCTTGTTTCATGTAGCCTCTAGGCTTTCCATCAGCTTTTCGGATCATTGTGAAGTGGGGGAAGTGTTTGCTGGATGTGCGCA
CTGTACCACGACTATAAAGACCAATCGACCTTAGCGACTCTAGTAGCACGCAGGAGGTGTAGAAATTATCGGTATTGACAACGCGATTAGATCCTTTCAA
AGACTCCACAACTTCAATTACGTGAGAACGAATTTCAGACGACTTCGCTGTCAGATCAACAAGCTGTAATACCTCTGGGCTTGGAACCACACCATCCAAA
CGATCTTTTAGTTTCACTTGCACAGTGCAATTTGAAACTCACGACGTACCATGATGTCAAACAGCAACAAGCATATAGCATGAAGTTATATTTCCCTGTC
GGGTTTTGGGGATTGAAAACGATAATATAGTGAGCGTATTGCGAACGACACGCAATACTAGCTTCGTCTACAGCCACGTTTCGGCCG