Description :
From Genome Similarity Track
Location :
Scaffold_96:77818- 89468
Sequence
11650 bases(100 bases per row)
ACTCAACATTCTGCTGCTACGTATGTTGCGGCGGTCGACCTGTAGGTTGCGTTTGCTGCCATTATGACCGCTAATGGATCGAAAGTGGATCGGGCGCTTG
CTCGTTCATGACTTCGCTGTCAATATCGTTGTTGTGGACGTTGTAGTCTTCATCACTTTTGGCTTCGTCAGTTGCACTATACTCTGATATGTTGCTGTCG
CTTGTCTGCGCGTACTTGCCGCTGTCGAACGTCTCTTCCATTAATTGGGCATCTCGACTCTCAAGGATGCGACTGCCTGATATCTCTTCAAATCGAAACG
CTTTTTCGTGGTCCAAGTGGCCCAAAAGGCGACACAACGTTGACCGCGCATCGAATTTTGACCTTTTCTCTTTGGGCACATGCACATATGCATGGAAACC
AAAGACTTTTAGATTCTTCAACAGCGGTTCTCTTGCGTCCATACCTCGTGTGGAGACTTGTCATGACCAGTTGCTCGCGTCGGGAATTGATTGCGTAGGA
ACGCTGCCGTTTTCACTGCTTCATCCCAGAAGTGCTTGGATAGTCCCGCGAACTTAATCATACATCGAACACTTCGACCAGAGTCTGGTTTATCCGTTCG
GCCATTCCGTTGAGTTGAGGCTTGTAAGGCGGCTTGAACTGCTGTACGATGCCGTGGTTGCTACAGAACGCGGCAAACCTTTTGGACACTTACTTACCAC
CGTTGTTGCTGCAAAGCCCCTTGATGCAACGACCGGTCTGAGTCTTTTGCATGAACTTGTCCAGCACTTCTGATTTGCTTCGAAGTAGGTAGACCGCAAA
AAGACCGTGACTTGTCGTCGATTGAACGTCACGAAGTAGCGTTTGCCGGAAAATGTCGTAGTCTGCATCGGTCCGCACACATCGGAGTGCACGATGTCAA
GCAGGTTCTTGGCTGGTGGATTGCAGTTGTCTGAAAGTTTACTCTCGTCTACATCCCGAGATCACATCCGCTGCAAAGCTCCCACTTGCTCACTGATGCC
GATAACTAGCTTCTGCTTCAAGATTGCGTTGATTCCACCATGGCCAATGTGGCCAAGTCGTAGGTGCCTCATGTACGACTTTCTCATCTTTGGATCCTTG
AATTCACTTGCAACGCACGCATCCTCCACTTGCACAGGTGTCATGCATAGCTTGAAGAGACCTTTGCCGGCATGCTCACCGATCTTCCACTTTCGGTTCT
TGAAACCCGCAAAGCAAATACTCATGTCAAACGTCACTGCCATGACATGCTTGGTGAATATGCCGATCGAGAACCGACTACTTGTCAGCTTTGGAATGTT
CCACACGTTTGAAGCACACCTTTATTGGCGCCACTTGGGGTCTTCATCGTCATCACTATGTCGCCGATCCCAATCGCCTGCACAACTTTGTCGCTGCTAG
ATGAACGTTAACCGGATCTATGGTCTACTAATTCGTCATGAACCATTTCGAAAATGACATGTGCTTCGTCGCACCAGAGTCTATGAGCCATGCCGAATTA
TTGACGCTATAGTTGATCTTCTTTCTAACGGCAAAGAGAAAATCATTCGAGCTTTCATTTTGGTTGTGCGCCACATTTGCACGCTGCCGGTCTGCGTTGT
CTTGAATCCGCGAGTAACATTCCGCGATCCAATGACCCATCTTGCCGCAGTAGTTGCACACGCCAGTCTTCTTGGATGGCTGTCCACTGCGCTTCATATT
ACCCGCCATGAACGCTTGACCTGCAGTGACCTCTTCGCTGCCTTTCTCCTTGCGCTTCATGTCTTCATGTAGGAGCCAAGACGTCACAAGTTCCCACGAT
AGCGAGTCGGTACTTGTGGATCCGACACCGTGATCAGGAACTGGTTCGACTCACTTAGGCTACCAAGAAGCGGATCACCAAGTCGTCCTCGCTGACTGGA
TCGCCGACCACATCGAGCTACTCCGCCGTAGTCTTGAGCTTGTTAATGTGCCCCAGCACATCATCACCTTCATCCATCATCGTCGTGAAGAAGCGTCGAT
GAAGAAAGAGCTTGTTCGCCGGACTCTTCTTTTTGTAGTGCCCTTTTAGTCGTGACCATGCATCGTACGCTCCAATCGCCGAACGGACCATCGGTAGCTG
CGATCAGCAAGACAGATGGTCGCCAGCGCCTTGCGCAACTTGTGATTTAACGCTGACTGGTCCAGCGCAGTGTGTGGTCAGATGTTCCAACTTGATCTCC
CCGCTTGTCACTTCCCAGAAGCCCCCCCTCCTGCAGCACCATCTGCATTTTTTGAATTTCCAATTATGGTAGTTCGTCCCATCAAACTTGTCGATGCGAG
AGCTGGTGGCGGGAGCAGCGTCCATGTTGAAGGCGAAGTCGGCGTCGGAGCCAGAGCCAGAGGAGCTTGGCTCATAACCTGTTTATAAAGATTTTTGTTG
TGAGATGCAAAATGTAAAGTAAATATATGTAGGTCCTTAGTTCGCAATCTCTTTTGCTACTCTAAGCCTACTGGATATTTCGACTATCTATTCCTATTGC
TATATCGCGCATACTAATCATATAGTCGCGCATTAGTAATCATCACGTCGCGCATAACTAATCATCGCTTAGTTGCCGAGGTGCTTCTTTTATAACAATA
CCCTCGTTAGGCGCTCTGTTGAAAACTTGACGAGCTGTCCTTGGACGAGTTTAGTCACTCGTTATAGAATGGTGACCTGTCAGAGGTGGTGGTCATTAAT
CCGACATATTTCAGTTGAACTCATCATCGCTTCTGGATGAGACATTTCTTGAAGACACAAGAGACACACTTAGTGCGCGAGTAGATCAGCAGTATTTAAA
AATCTTCACGATCCCTTTTATCCTTTAATTAAGGAATTTCACGACGTGGTTTGCCACAATCCACCCTCTGTCTTTTCTTTAGATAGAGGTGTGCGTCATG
AAATTGACGCGGTCCCTGGGACCAAATTATTATATCACACGACTGTTGCCCTTACCAAAGGAGCAGCGTGATGTCATTGATGACTTGTTCCGTGCCAAGC
ACGAGGCAAAAATAATCCGGAGAGTAAATATCCGCATTCGACACCGGCATTTTGTATCAAAAAGCTAACAGCAAGTAGCGTATTTTGCATGCTTATAACA
AGCCTAATGCGGTCACTATTGCGGCACAGACACCCATTTGTGGAAGGGAGATTCTGTAAAAAAAAACATGGCTGGTTGTACCTGGCGGATGTTGACAACC
ACATCGACCATCTACTAGCAGTAGTTGAGTGCATGCGCACAACTAAGTTGTGTGCCAAAGCGTCTAAATGCATCTTTGGTATAGAACAGATTTCTTTTCT
GGGGTGTTTCATCGTAAAGCGCGGCTTCAGAGCGTATTTTCGCTAAGGTGAAAGCTATAGTTTACTGGCCAATTCCTAGAATCAAAAACATTACGTAATT
GGCTCGGCCTTGCCAATTATCAGAGTAAAGGCATAGCCTGAGGTTGACTTGCGATCTGCGTGGTCGCCAGCCCAATCTGCGTCAGAATACCCGCAAAAGT
GTTGGTTTCTGAGCGGGGCTTGGACGTGCGAAGGGGAATTCTCTTGGGAAGACCGAAGAGAAGACACTTGAGCGGAAGAATGAAGATTCGAAAGTGATTG
ATTTATCGGAGCTTATTCTACTTGCACCCTGATTTATATGTGGTCGACATATAAATCAGGTGCGACTGTTCACGCCTGATTTATATGTGGTCGACATATA
AATCAGGTGCGACTGTTCACGCCTGATTTATACGTAACCGCCTATAAATCCAGTAGATCTTCCAATCAATCTACTCCTCCAATCAACTCTAAGGTAATTA
CCGTCGTAACAACTATCCCGTAAGAACTCACCCTTGAAGTTCGGATTGTACCGGTAACCCTCAATACGCCCCTTCAATCCGAACACGCGTGGATGCCGAG
AGCCGCCGTCAGATCCTTGTGACGCGGTCCAGGTGGTCCCTTGGTCATGATGTCTGCCAACATGCAGTTGTTTCGCAGTACTCGAGCTTGACTTCACCTC
GCTTGACCTCATCACGGATGTGATGGTACTTGATGTCGATATGCTTCGCTCGACCATGGTTCACCGGATTCTTCATCATCTTGATGCACGACTGATTGTC
TTCGGCAATGACGAGGTCCGGTCCTGGCTCGTTGGCTGCCGTCAAAATTTCGCATAGCAGACGATGCACCCACTTTGCACATTTATAGCTTCATTACGCT
GATATAACTAGGCCATTAACTGATCTCCTTACAAAGGACACATGGTGGTGATGGAATATCATTCATACTAACGCGTTCCAACAGTAAAGAAGATTTTCCT
CTATGCTCTCATTTTAGCGTTAAATAATCATGAGTACCCTTTTAGTGTCGTCATGGCGCATCTGACTTCGCCATAGACAGCGCCCTGATGCACAGATATG
CTTAAGTATTCGAGCGTGTCATTGCTTTTGAATCTCGTCAGCTCAGAGCTGCTGAGAAAAATTATCCAGTTCATGACAAAGGGTTACTTGCCATGTAGTA
TGCTCTCGAAATTTAGTGTTTATCGGCTTGGTTCCAAGCTATTCGTCGTCTATACGGATCATGCGTCGTTACGCACGGCGACAAAGTCGTCTCACCTCTC
TCATAGAATGTCCCGTTCGCTTTCCTCCTTTGCGAAATATGACTTCGAGGTGAAGTATATGCCGGGAAAACAGTGCGTGCTAGCGGATGCTCTCTCTCGC
TGACCTAAATATCAGATAGCTCATGGTTACGACCTTGTCGGCTCCGGTTGAGGATTTAATTCGTGTGACATATGCACGATATCCATAATGCGTGTCATTG
CTCCATGCTCTTAGAAGCGACGCTTCCAAAGACTCGGACATTAATTTGTCGGCACGGTTAAGTGCCAACCTAGATCGACATTATATCTATCGCGGCCTCT
TGTGATATTGCATGGATGTAGTCGATGATCCTCGCATCGTCGTGCCTTTGGACGAGAAAATAAAGTATCGAATGCTTTTTGAGGCCCATGATAATGCTCT
CAGGGAAAGTTTGGGCGAGAGAAGACTTAGTCTCTGTGAGTCAACACTATAGTGGCCCAAATTATACAAATGGATCAGCACATACGTACAAACGTGCGAA
ACTTGTCAGCGGGTCAAACCCTCTGCGCACTCGGTGGCACCGCACGCTAGTTTATCCGTACACTGGGTGTTGGGAAACCATCAGTGTGGACTTTGTGTTC
GGTCTTCCCAATACAGCGACGACAATACAGGCATCGTGGTCTTTGGACAGTCTGAGTAAAATGACTCACTTAGCACCGTGCCCGAATCAATTGAAGGTAT
AGGTACAGCTATGCTTTTTATCAATCGTGTGTTTCGTCATCATAGGTTGCCAATGCCAATCATCTCTGTTAGAGATCCTCGCATCGCAGGAAAGTATTGG
ACGTCCATATGCAAGGTGCTTGGCACACAATTAAACATGCCTACTACGGATCAACCGCAGACCCATGGGTATACTGAGCGAGTTAATCGCGTCGTCGGCG
ATGTCCTTCGCATTGTTTGAGCTACATCAACTAATCCTTGGAGCTTGATGATTCCTGTCGTTGAATTTGCGTAGAACAACGCCATTTATTCCTCTACTAG
AGGAACGCGCGGCAGTGTGAGACTATGCACATAGAATAGCCTCACAAAGCCGCGCATACCGCTCACCCTACCGCTGCGTGGATCCGGGCTTTGTGGGGGA
GAGGTTGCCGACAAGCTTGCTGATATCAGCCCTACCACAATGCAGCAATACGCGAGCGAGTTTCTTGCGATGCGCTTTAGTGTCTTATGCCATGTGCGTG
ATGAAATGGCTGATAGTCAAGATAAGCAAAGGAACAAGCTGGTGCTGAAGGCAGCAGATAAATTGATTCTGATGAAGTTAAAGAAAAAGTCTTAGAAAAC
GATAAAACCCAACCTACAAAAGTAATGTCTGCTGTATTCAAGACAAAGTTGCTTCCGCGATTCATAGGACCGTTCACGGTCGTAGCTAAGAAAGGCTTTG
CCTCTACGCTGAACCTTCCGCGTAATCTACGCACACACCCAGCTTTTACGCTGCTTGTTTAACTCGTTATCATAATCCTTCTCTTGTGTACCGGGAGACG
CTTTCCCCTGGGAGAAGGACATTTCCCGGGATAGATGAATTTTCGTCAAAAGATCTACCTGGCCATCCAAACGATGCAGATTGTAATTCACCTTTCGAAG
CCCTTTGTCAGCCGATTCGATAAAGCCGAAGCGTTTATCTCCTCAAGAAACTGAGCCAACGCAGTCGATGGATGCTCATAAGTGCGCTGCACTTTATCGA
GGATCTCCCGCAATTGTTTCCTCTCAGTCTCCCACTGATCCAATGCACTCTGCATGCGAGCGACAGACTCACGGAGGCACGTTTCCTCAGACACCAACTC
TTCCTTTCCTGTACCGATAAACCGGCCTCCTTCGTCGTTTCTTGATGAGCAAGGAAACTTACATCTTCACGTGGAAAAGCTTCTTAAGTGGGTCTTCACA
AAGGTCAATACCATTAACTGTTGAAGTGGCGTGGATATTATGAGTCTGAGAAATCATGAGAGTTTAAGTTGCCACTTCGTCAAGATTGCCCGTACGCTGT
TGACATTTTTAAGCGTCGTGCTGAGGATCAGCTTGTGCCCAACGCGCTTCCCGCCATTGGTATGGGGGTGTAGAGGCCACTCGCCAAAGATGAGTGGTCC
GCGACTGCACGCGCAGTCGAGGCATTGGAGTGTTAAACAGATAATTGTTTTGCGTATCGAGTGAGGTACATTGATCGCAATTGGCCTTTGGCCTTCGGTT
CAGTGAACTCATATTGCAGCTTGCACTCTAAACAAGCGTCTGCCTGCGCTATCTCGAATGGCACTCAAGCTGGATAAGCGACGTGCTCCATGAGCCCAGC
TAACGAACGTGATGGAGTCCTCTGACTCATTCTCTTAGCGGCAAAACAATTAGGATTGTCCTCTCCGTGGGTACAGACACACCGCGTGTTTGCTCTAGCA
ACTTGGCCTGGTATTCGTATAGCATGGTCATTTATAGCGTTACTTAATCCTCTCCGAGAGCATCCCATTCGGCAATGTTGACGACCGTAGTAGCATCGGG
TCATGCGAGCCAACTGGTTAATGAATGCACTGCAAACTTTCGCAGGAGTTCATCACGTTTAATGGCTTGAATATGGTGTCGGTATGAGCTACGGCAATCG
CTTAAGTCTAAGATAGACGTCTAGCTCTTTCTTTGGCACCGACATACTGCTGTTGTTATTATCTAGCCTGTTGGTGATGATTCCCTCCTCAATGGTACAA
GATGAACAAAGCGCTGTCATAATAAGCTGTGCCTCGTAATAAAGGGGATTGGCGCTATGCGCGAGGGCTCTAGACACCTATTATATCTACCGTTGTGTAA
AGGGGTAACACAACGGTTGGCATAAATGTGTGATGTCGCGGTATCCACACACAGAAAGATCAGTGAAACTAATAAGCGTCTTATTGTATCCAATACGCTG
GTGGTATTACTGTGGTGAACCGGTCGGGGAAAATCGTGACCAATCGCAACTTTTCGCATCACGGGTACGCTTGGGACCGGTCACAGATGCTTTGTGACTA
ACTGTCGCAGATCTCCAACGGGATGAAGGAAGGTTGACGGGTTGTGACCATCGGTTACGATCACCGGTTATGACCATCGGTAATGGTGGTTTTGGTGGAC
CACTTCGATGGGACCAATGAATGATGGGAGGCGAAACTACGCAACCGAAACCGAGATATAGAGAGGCATAAGCGTAGTTCTAGCTGATAATAGGTTAATA
ACGAACAGTATCGATTTTCCTACAAAAGACACACGTCAGCATCCCCCGGGATGGAATATCTGTGGTCACCCGAAGTTTAAGGTATGTTGTGCGCATGCTT
GCTCAAGGTTTGTCCCTAGACTGTTTGGATAAGGACGGAGATACTCATTAAATTATCCCTCGATCGGACGTGGCAAGCATTTCAAGGCAAGGTCTTCAGT
CGGCTCAAGCGGTCAGAAGAACAAGTGGATCACGTATTCGTATTCGGGGAAGGCGACCTCAAGGAAGGTCACAGCTACTCTAAGTGGTCGTGTGAAGATT
TACACGCGGCCACGCCCAGCCTATCCCCAACTCGGTCGAGACAGACATCGACCTCAATCACCCAGAAGAGTGAAACCCGTCGGCAAGTCGGAATAACCTG
TGTTAGGATTCCTAGTTAGGTATCAGAGCTTAAATATGTAGATAAGGTTTATTATCGCTATAAATCAGTTTGATAGATTTAGGTCCCCTTTTGATCATTC
AAATATACGTGTCTGAATTTGACGTCTTTGGCCGCACGAGTTAAGAACCTTTATTAAGGCTAGTACTCTTGGGAATTAGTTCCACATGATTCCCGCGAGT
CCCATGAACCAGGACTAGAATCTTACGAGCTTGCTAAGATATTAAAGACCAATATCATTACGTCTATAAACACTTATGACTCATTAAGTTTATACCGTCT
CGTTTAATACACTGAGAGACTCTACGAGTCTATACGTCTTCCTTTGACAGAGCAGTTAGGGTATCTTCGCTACAAGTTACGTGTGGTGCGGCAGTTTACG
TTCATCGTGGGTTCGAAGATATAAGCGCTGACACGTGTCATCCATTAATTAGTTTTTATACCGCGTTTGCTGTAAGATTACGCGAGAGTACATATACTAG
GTTTACGATAGGGAACAAGCTCTGTAGCCCGCCCTTAGAAATTAGTAATTTAGTTTATATAAACTAATTCAAGTTCTGTATATCTACTTACTAATACGGG
TGGTCGGCGGCTAGGGAATGATTTGTGCGTTGTGTGTGAAAAATATTAGTAGTTAGTGATTGTCGTGTGCTAATGATACTCGTTGATGTTGTTAAGGTGT
GAAGAGTCGCATATGATAAACGGAGATGGAGGGTGATCCTGCTCGGCAACGCCGTCTCAATAAAGGGCGGCCAACGACATATATTGATTAATGAACAAAA
GTTGTATTCAGGGAAATCCTTCTGCCACCAATAGTGGAAGGTGACCATAACTTCTTAGCGGTCTACATCCATCCGTTAGGGACCATAAATTATTGAAAGA
TGACCATTATCATGCACAATTAATATTGGGAAAAAAATTTCAGCCGCCACTCTTTCGTCTATCAGCCACGACCCACCAATAATTTATATGATTTAGTATT
TAAGTTGAAATGTTATATTTCTTGATAAAAAGTAAGGTAGAGTGTTTTTACCTCAAATATTTTTATTATTACGGTTTTTTAGCTGCCATTTAAAAAAATT
GCAGGTTTGTTTATTATTGCTGACTACAATGAAAGTCTTGAGTCACCGCCAGAAATTATGTACGATTCTTTGGATTTGGAGATAGGAAAGGCGGCAATTG
AAGCCCATGCACGATAACAAGACTATGTCGTTGTTGCCGAACGCACAAATAGGATAGGCAATAAACGATATGTGGCCATGAAATGTTTGTTGTTACCCTG
CTCCCGGTCAAACTCCCCAGCGATACGAAATAGACCTTGCCAACGTCTTTTCTCCAGCCGTAGCACTGGGTGTTTGTTCAGGGCTGGATTTGCTTTGACA
TCTCAGTCTCATGTTGCGCCAATCACGAATTATGAGTTTGCCAAACTACTGCTGACGTTTCCATCTTTCATTCTTCACCCTGTGACGCCGAGTCCTTGAC
ATGTATTAGCACATCCCAGAACGATGTCCTTGTTCGCATTTATAGACCCATTTTCTACCTTTGTAGACAACGGCCCGTAAAGCAATAAGTTTTGCCCATT
TATATTGGGTTTATGTACCCTCGTGGATCTAGAAGCAAGAGCAACCCGATTTCTCTTGGTCTAAAAGAAACTGGCCATACCCTTCTTGCTCGTCTGTTGG
CCACAGAGCGAATAACATTAGTACATATATGTAGTGCCGCCACCAACTTTGATCAAACACAACACGTGCGTCTAGTTTTTCAGCACCTAACACATTATTT
TGTGAACAATGTGTTTAAGGGAGGAGTTAAGCACCCACTCCCTCGCAATAACTATCCATCCCCTTCCGCACTTACGATGCTCTGATTGGTCAATAAAAGA
AATGTAATGAACAATCCCTGAAATATTGTTGAACGGTAAACTAAATCGCCGGCCCATTCGATACGTTTGTGCCAGGTCCCACGAAGATCAATCCCTCAAG
ACTGTGATGACCTCGTTGAGGTGCAGTACCGGTTGGTTTATGTTCAGTAGCACATGACCAGATCTTCGTTCAGTCAATCGTGCGTCTGGGCAAAATTGAG
CTTGTTGTGGACCTCAAGATCCGACCCGGAGAACAGAAATAGTCGACTACGAGATACAGGCCATGAATATAGTTATGATGACTCTGTAGTAAAGCGGATC
GAAGCAATCGGGGCGATCGTTGGATGGAGTGATCTCAAACCGCGACAGTTCATTGAGAAGGATCGATTGGCTGTTAAGCTGCGCAATACCAAGACCGAAT
ATCGCAATATCAAGATCAAATACCACGATACTGAGAGTGAATGTCGCAATACCGCGATCAAATATCACAGCAACGGGATCGAATATCAAGTTGCCAAGAT
CGAGGCAAGATACCAAGATCAGGAATACATAAGGTGTTCAAAGTCGGGAAGATGACCGACAAATCGGCAGGGTCACGGTCCTAGAGAGTGATCGACGATC
AAGTGGATCGACGATCAGGAGATTGACGATTGATCAGAAGATGATCGAACAAGTAAATTGACGATTGGTCAAGGAGATCGACGACCACTCAAGTAGATCG
ACGATCGGGGGGATCGACGATCGGTCAACGAGATCGACGATCGGTCAACGAGATCGACGATCGGTCAAGGAGATCGATGATCAATCATCGGAAGTGGACA
TCATATGCAAAGGAACGATCAACGGAAGGTAGAGGACATGTGGAAGCATATCCTGGCATATAGGCAGGCATATTAGTAGCTTTAGCGTTTGGTTGGTTGA
CATTAAACAGAATTCTATTTGCTTCTAAGTTCACGTGTCGACTTCTCTTCCGGGCTGGAATATTGGCATCCCGACGTCAAGAAAGCCGCGCATACTGAAA
CCAAGTGATATCCCCAGATAATTAGCTGGGAATCAAGAATTCTCAAGACAATCACAACTGCGATTGTACGCAGCAAGAACGTAAAGGACAAGGCGCAAGA
TCGAGAGACGGCTCAAGTGGTCAAAAGGCTCGCATATTAAGCATCCACATAGTGGACAAGGCGATCTCGTTGAGATCAAGGTGGCTTACATCAAGTAACC
TACAAGTATACCCGTGATCGTGTGAAGGTTTCCGTGCGATCACAAACCCCATTCCCAACACGGCCAAGTTTTCTCTCGACACGAGTCCACCGAGAAGAGT
ACAGCCCGCCCCACCGATGCGTACACAAGGTGAGGAAGGAAATACAAGGCACGGAAACGGAGTACCCCCTCCGATAGTCGGTCGTCTGGGCACCAGTCGA
GAGTCGGGATCGTCTCATAAAATGAGCGATCGCCACTCCACCACAACTCACTGGGACTGCCGTAGTGGTAATTGGAGGCCTAGTCATGCATCCGCTGCCC
CCTGAGTCAAATCTCTCCGAGAGGAAAAGCAGCTTAGCCGTCCGGTTTAA