Description :
From Genome Similarity Track
Location :
Scaffold_685:7780- 13492
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_685-snap-gene-0.5Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_685-fgenesh-gene-0.3Conserved gene of unknown function
Pytar_ATCC12531maker-par_contig_685-snap-gene-0.6Histidyl-tRNA synthetase

Sequence
5712 bases(100 bases per row)
TGGAATATGCAGACGTACCTGCGCTCGAATGCCAAGATCAATCGGCTCGTGCAGGCGGCGCTGCTCAAGACGCTGATCCACGCGATCCGCCGTGGGTCCG
TCGAGGGCGTCCGCGTCGCGATCGAGCGCGGCGTATTGGTCCACTATCTCGACAATCGTCAGCGGAATCTGATCATGTACAGTGGCGGTGGTGACTTGAC
TACCCGGGTGTTTCCTCTAATGCGTTTTGGTTTGGTAGGCTCGCGAGCAAGTGCGACACGGACGCGCGGTTGCCGATCGTCGTGATCCTCTCGGACGCCG
GCTGCGATATCAACCACGCCGACCAGCTCGGCTGGAGCTGCCTCCACTATGCATGGTACGATTTACGATAAATCTCCCCGCATGTGGGCCTATAGTATGC
TGACTGTGTGTATTGATAAACAGTGCCTCCGGCGCGATGGACGTTGTCCAGGAACTGATGCGACGGTGCGAAACGAACTTGCTTTGAGTATATGAAAGGA
CCAGGAGAACTGATGGGGCTGGACTTGTAGAGGCGCGCGGGTCGAGTACAATCCGTATGGCTACGGCCCCGAGGACTTTTTGATCCCCAAGGTGGCCAAG
GCCAAGAGCCTGCTGCAGCACACGGAACAACTGCAGCATGAGAAGAATGTCAAGGCGTGCTGGGACGTTTTCTCGCGCCACGCCGAGCGGTGTGGGTACG
CAGTCAAGTGCCGATCGGTGAGCGCACCCTGAGAGGGTTCGAGTGTACGCTAATATACTAATGTATTTTACCATTTGTGTGTCCTGCCCAGCACTGTGAC
TTGGGCAAGCCCTTGCGGGTCGCGTTTCTCGCGCCCAGTGGCCACAGCTCATTGGACCGCATCCGCGTCGTGGACATGAACTCGGACGTGGCCCTGTGGG
AGCAAGTGTCCAAGAATTTCACGATTCCACCAGGTGCGTGGTTGGCTTTCGAGATGGGGTTTTGTGGTCTTGTTGTGGTGCTAAGTTGTGTGATTTCGTT
AGGCGACATTGGCTCCATCACCCTCGACTCTGAGACGCTCGACCGCCCGTCGCTGTATCGGATATTCTACGAAAAGTACGAGCCAACGCCGCTGCGTGTG
CCTGCACAAGTGGCTGAGAGCACATTTTCGATCAAGAATCTGGACACGGGCACGACGGTCTCCATTGGCAGCGTCAACAATCTTGTGCTGAAGGAACTGG
AGTCAACGCGGGCTGGCAGGTGCGCTTTGTCTAGTTGTAATCTGGTTGAAATGGGTACAGGTTTGCTGACGGTCTCATCATGATCGATCCATTTCCAACT
ATCACAGAACCACAAAGCACACCTCGAACTCCTCTCGGTAAGAAATGGTGGACAACGGGCGGAGGGAAGGAAAGGGCCTTTCTCATCGACGTATTTATTT
CACTGTTGCAGGGAGGCACCCGATTCACGCACCAAGAGTGTCCGGCGCATGTCCACGTACGTCCTGTATCTCATCCTCAGACGTTACCTTCTCGTCATTG
ACCCTTGGGCTGTCTGTTACTACGTCAGGCGTTCGGGTCGGCTGACAGAAAGCGAGCACGAGCCATCCGAGACCGAGAGTGACGACACGGATCAAGAAGC
GGTCCCCAACGATACGATCACTGTGGCCTCTGTCGAGCAGCACCCGACAGTCAACAGCATCACGGGCGTGTATCGCATTGTCGCGATGGCGATCGTGAGT
GTCTCAACGCTGAACAAAGCCAAGCCCAACGAATACGAAGTGACGATTCGCAATGAAGGCCGCATCGGGCTCCACATGGAAGCCAAGACCGATGCGTCCA
AGCGCGTGACCAAGTTGATTGTGCGCCGCAGCTCGGGCCAAGCGGCCGCCGTGAATCCCGGCGACTGCCTCGTCGCGATCGGCACAGCGAATATCGAACA
CGCCGGTCTCAAGCACACGCTGTGGGTGCTTAACGAAGCGCCTCGCCCCACGATGCTGCGCTTCCGACGAGGCACGCAGAACGAAAAGAAGAGTCTGTTC
ACGGGCATTCGCAAGCTGGCGGGTAGCAATCCCGCCAATGCCGCCATTTCCGTGTAACCCGCTAGAAGAACCGTGTGGTCAGAGTGCGAACCAACATGCA
GGTCGCCAAGAGTATTTGGACCGTCCAGGAGGAATATATAACCTGCGTTATGAGCATCAATTGATGTAGTGGCTTAAGACAGTGAAACAGCAGCATACAC
CCAACGGTTGATCTTTGTCATAGCATAGGATGCCCCTTGACGACGTGGCACTGGTAAAACGAGAGCTTCTTCTTTTCGCAGACCCGACAAATTGCGCGTG
GCGTTGAGCACACGTCCACGACGTGCTCCGGGTTTGCCTACAGGTTCGAAAAGCGTGAGGGTTAGTTTTTTTTGCTTCAGACAACGGCAGCGCCATTGGC
AGGTTCGTACCTGGAAGTACTCGAGGAGGTTCTGCGGCCTCACGGTGTATTCTTCACCCTTTTCCGAGTCGTAGACGATAGCATCCTCTGTAGAAGAGTA
ATACATGAGCTCGTTAATCCCCGCACCTGTCGATACTGAACGTGCGAAGACTCGCTGCGTACCTTCTCGTCCGTCGGCACGCCACACATACCAAACCTGC
GCTTCCCACCAAGTCACTTCAGACGCTTCATCGTGCTTGAACTATACCGCACGAAACGTCGTCAATATGTTTGTACACTCGTACCACCGCTCGCTACGAG
CTGGCAAATGGTCGTGGACGTACCGATACAGCGAGCATCGAGCCAGGTCGGATCGTGCCGACCCAGTCCGTCACTTTCCGTACGAAATCTCGCGGCGCCT
TTCCGTGTTGGTATCTATTAACAAGCGAAACCGTGCGAATAAGATCTCAGTTTGTCGTTGAGCTCGAACCGATATCACGTACGGTGTCAGTAGCTTCCAT
TCGCCTCCTTTGCCGTTCCGCTTCTGCTTGATCCATGGACTGTGGCCGTTGAAACTCCACGAGTTGGGCAGAATCGTGCGGGTCGGGTCGTTCGGGTCCA
GCAGCACTTCGCCAAACGCCCACTGTGGTGTGCTCTTACGCATGTCGCCCGTCTTGTAACCCGTGTAGTAGACAAAGAGCTTGTGGACCTGGCATACACA
GATACAGTCCAAGATCAGTACGTGATCTACTCTGAATTGTTCCCCGACAACGGCCACATACGCAGTTCCTTTGCATGTGCAGGTACCGCGACCACGTCTG
CGCCTTGGTCTTTTCGGCCTTGTATACCTTGTGCTTGCGCATCTCGTCTGACACAAACTCCTTGGAGTTGCGCTCAGCGATCGCGTCAATGTCGTCGCAC
CATTGGCGATTCACCTAGCGATCCACACACAAGTTGGTTGATCAATCAATCCAGCAAACGATCCGTAACCCCGTTTAACATCCTACCATGCTCAGCGCCG
CGAGATCGACCGCCGGCAAAAACTTGGCCACGACCGACTTAATGCTGATCTCGAGCTGCTGCAGGTTCTTGACAACGAGCCTGCCTTTGCTGCGCAGCGC
GGCGCCGCTTCGCTGGCTCGGCCGTGCCGACTTGAAGAGGTTTTGCTGGAATTTCTTGCTCTCGTAGCGCAGCTCACAGGAGCAGGGCGCGCGCTTGTTG
CAGCGGCGCGTGTGGATGAGGTCGCCAGTGGGTTCCTCGGGCGCCTTGCGCTTGGCAAGCGCCACAGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAACCAGGTCGCGGGTTTTATGACCTGTTTTCTGTTAAG
TTCGGTTTGCTAAGTTCGCATCGTTGCTTTGATGAGTTGCCGTTTTGTGTGACCACCACACGAAATGGCAATGATGATGAGACCGCTACGGTGCACGCGG
CAGCTCTCGACGGCCGCGGCGAAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCGACTTGCTGACGGACGATGCTGAGAGCCAG
CGTGCGGTCGTTCGGGCCATGCAGGAAATCGTCCAGCGGTACGGCTTCCGCCAGGTGCGTTTGATGTTGCTCGCTTCTGGAGATCCGTGCTGCTGTGGCT
TCACGGTATCGCTGACAAGGTTTCGACGGTATGCACGACGTATAGATCCAGACGCCGATGCTCGAGTACACGGATCTATTCTCGCGATCGCTTGGGGATG
GCTCGGACATCGTCATGAAAGAGATGTACACGTTCACGGACAACTCAGGGAAGAGCGTAACGCTGCGTCCAGAGGGTACAGTCGGTGTCATTCGCGCGTT
GCTGAACAATAACTTGCCCGTGACACCGCCGCAAAAGCTGTTTTACCACGGCAGCATGTTTCGGTGCGTCTCTTTTACTGAGAACTCATGGCCGTGTAGT
AAATAATCCCACCTGACGTATCGTAGCTACGAGAGGCCACAGCGTGGGCGATACCGCGAGTTCCAGCAGTTTGGTGTTGAATACGCCGGTTCTACGGGTG
CATCGGTCGATGCCGAGGTGAGATCTTCAACTCGCTTGACTCAGAAACAGGCCAAGAGACTGACAGTCCAACTCAGGTGATTCGAATGGCAGCCGATACT
TTGGCGTCCCTGGGGATCGAAGAGAACGCAGTCTTGCAGATCAATTCGCTAGGAGACGCTGAGAGGTGAGAATTTGTTGTGTCTGTAGAGTGTGGTAGGT
CACAAAACGCTGAGTCGCTCGGACTACTTCTATTGATGGCCAGTCGCCACCGTTATCGTGTCGCGCTCGAAGCTTTCTTCTCCACGTTCAAGCACGAGTT
GTCCGCCGACAGCGTCAATCGCTTGGAACGAGGCAGCGTGATGCGCATTCTCGACTCGAAAAGCGACGTCGACCAGAAGTTCGTGGAAGACGCACCACGA
CTGAAGGAGTTTCTGTCCAAGGAGTCAATGGAGGTAAGTAACACTCCAGTTAACTCTCTTGTGAAGAGCAGTGCTGATCGGAGAACCAACATTCCAAACA
GCGTTATGATGGCGTTCTCAATGGGCTGGAAGCTCTCGGTGTGGCCTATGAAGAGAACCCGCAACTCGTCCGCGGACTCGTAAGTGCATTTTGTCCAAGA
TTATCGATTGCTGCTGAATGGCATATATACTTACCGTCGCTTGTCTGCGCAGGACTACTACAGCCACACAGTATTCGAGTTTGTCGAGCGCGTTAAGGGG
GATGAGAGTACGGATTCTTCGCCAAAGGGCGGCATCGCAGTTCTTGCTGGCGGGTGCTACGATGGGCTCTCGGAACTGCTCGGTGGATCGGCCGTGTCAT
GCATCGGTTGGGCTGCTGGTGTCGACCGCCTCGCGTTGCTACGCGAAGGCATGGCAAAGGAGACCCCAGCGACCTTGGCGGTTCGTACTATTTCCAAGCA
TCTCCTTACATGCATAGAAGCTTGGACGCTAAACGGTTTTACTCTTTTGCTATAGGTCGTGCCGGTAACTGCGGGGACCGAGGGCGATGTGGTACTCCAC
GAGGCGCTTCGCGTAGCCCACGCGCTTCGTCAGCAGGGCCACATAGTCCACTTTTGCCATGGTAACGGTTCGATGAAAAAGCAAATGAAAGCGGCCGACC
GCTTGGGCAGTGCCTTTGCCGTCATCGTTGGCGGCCACGAAGTGCAGAACCGCTACGTGCGAATCAAGAACCTGTACAAGCGCGAAGAAGAAGACGTGCC
ACTGGATAAGCT