Description :
From Genome Similarity Track
Location :
Scaffold_92:7780- 8904
Sequence
1124 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCAGTGGGATAGGTGCAAGTGGACTTCGTGCGATGCAGCTAGCTTTAGCCATGAATTAGACCAGACCCC
AAACAGCAAAAGTCGATGGTGCGTTTCGGGAGCGTCATCGGACGAACGAGATAATTTCCACCTTTGATGAATGATATTTTAGCTTTTTGCATTAAACTCT
ATAAACGAGAGGGTAGAGGCATACGTGACTTGACTTTGTATAACGTCGGTCACTGGGAACACGTCTGTGTAGTGAATCGCAATTCAGGATGTCACGACCT
AGAGGATAGTCTGTACATGTAGGTGGTTCCATCTCGTACATAGCAAAAGCAAGAGCCAGGGGATCGGAAGCCATATGCTGATGGAAGGTGGTCGTACCGA
TACATTGTACAACATACAGTTTCAACAACAGATCTCAATGAAATCCTACCTGGAACAGCCAGTACATGTACGGGCAAGTATCAGAATCCGTGGAGATTTC
AAACTAGATGCAGAAAGCGTGGTTGATTTGTCCACCACGTTTTCTGACACACAAATTCGCTAAGTGTGCAACCTTGTTATGGAGATGTTCTTTATCGTCG
CGAAGCAGCACGTGCGGCCGTACGTATGTCCCTACGCGAGCCTCCAAACCAGTTCGAGGTCGCTGGGTGTCGACTCTCGCACTCAACAGTATTCTAGACA
CGCTTGTATACAATGAGCACTCTT