Description :
From Genome Similarity Track
Location :
Scaffold_673:778- 4814
Sequence
4036 bases(100 bases per row)
GGCGACGGAAATGCTGCTCCAGCCCCTGCTCGAGGTGTAGTTTGCGATCTGGATGTTTGAAATGTGCGGCCAGTGGCTCAGCGTGCGCGATAAATTGCTC
CGCATTTGCTGGTCAAGGTTTATGAGTTGCTCAAGAAACGCCTTGAAACGGGACTGATTGAGCACTCTGAATCGGAATGGGCTTCGCCGATCGTCATCGT
ACTCAAGAAGAACGGAGTCGATATCAGGATGTGCATTGACTACCGCGTGGTGAACGCGTTTATCAAGCTGTCGCGGTACACGCTTCCCCTGATCGACGAT
CTTTTGATTGGGTTTGAGTCGGCAATGTGGTTTATGAGTTCGGACATGGCTAGTGGCTTCTGGGCGGTGTTGATGACTGAACGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNAGATCCTGAAACGCAAGATTGTCTCGACCCCGTTGTTGCGTCACCCGGACCGCACGAAGCAGTTCGTCATCATTCCACATGCTA
ATCCATGGGCTGCTTGCGCAGTTTTGGGTCAGATGCATGATGGAGTGATTCAGCCTGTGCGATTGACTGGACGCATATTGAACGAGTTCGAGCTGCGTTA
CCACATTGCGGAGAAGGAGGTGTTGGCGATATTGAGAGTGTTGGAATTGTTCCGGCCGCTGATCTACGGTTCAGCGTCCCCTGTAGTGATCTACACGCGG
TACTCAGTGCTGAAATGGTTGCTGAACTCGAATTCCATCGAAGGTCGCTGCCTGAAATGGGGTTTGGAACTGTCTAGGTGGTCGTTGGAGATTCGTCGCG
TTCAACGAGACGAGGATGGCCTTGCTGCTATATTAGGGGAAGGCATTACTCCACGTGAACACTTGGACGCGGTCGAGGAAGAGCTGATTCCAGCCAAGGG
ACGCGTCAAGAAGCCACCTGCGGTCAGAATTGAAATGCTTGAATCAGACTATCAGGGTGTGGTTCTCAGCTTCGATGGTGCGGCCAAGACTTCAACGCGT
GTTGGGAGCTGCGAGTGTGTCCTCTGGCACTTACCTGGTTGGGAAGTCCTGGACGCACGTGGGTTCATCCTGGAAGATGTGACTGTAAACAACGCTGAAT
ACCATGGACTGCTGAATGGGCTGAAAATGGCATCTGAACGAGGAGTTGAGGACCTGGTCGCAGTTGGTGATTCAAGGATCGTGATTCAGCAGGTTCAAGG
CTTAATAAACTGCAACCAGCCCAACCTTAAGCGCAGGCTAGCCGAATATGAAGTCATCCGGACGAAGTTCAAGACTGTGCAGCTGGTGCATGTCAAACGC
CTCTACAATCAGGCTGCTGACTACCTGACGTCGAAGACTCTAGCGTTGGGCAAGTCGTGGCAGGTTGAGGACGCCGAAGAACGCTTGCACCTACGACTCG
TGTCGCGGATAGCTAAGTAAGTGATGAAGCCCTCTGGGACCCCGAGCGAAGCGCAAGTGCGTGCAAGGTCTGTGGATGCTGATCTGGATGGAGTGCGTTC
AGACTTTGACTCGGCTCCTTTGACACCTGCGGCCAAGGTTTTGGCTGTCATGACCCGTGCGCGTTGAAGGGACGAAGCTGGTTCAGGCGAACCAATGGGG
CCTGTGGAATATCAGGCAGAGCGATGGTGGCGTATCAAGGTTCATCAGGATGGAGACATCTTCCTGACGCAGATCACGAAGTATCTGAAGGGGGAACTTG
ATCAATTCTCCCACGCTCAGGTCAAGAAGATCACCAAGTACGTCGACCAGTACGTCCTGGATTCCAGAGAAGTCTTGTATCGCTTGGACGCAGCTACCCG
GGAGTGCCCTCGTGACAAGGAGTCAGAGCTGAGATCGGTTGTGCCGACAGACTTGCGTCCAGACATCCTGCACTATGCACATGAAGATGTTCAGGGCGGA
CACCAAGGCATAACTCGGACGTATGAAAAACTGCGTTCAGAGTTTTACTAGCCGCGGATGTACGCTGATGTGGAAGTTTTCGTGAAGGAGTGCACTGACT
GCACATCCGCCAAGGGACGACCACTGAACTCAGGACCTTCGCCCGGCAACATTGAGCCTAGTCGCCCGTTCGAAGTGGTGTCCATGGATTTCGTCACGCA
CCTTCCAAAGTTTGAACGCGGAAATACCTTTTTGCTCCTGTTTCAGGATGCATTTTCAGGCTATGTGATGTGCAAGCCGATGAGCTCGACAACTGCTCAG
GACGTGGCCGAGGCGTACCAAGAGCGTGTTTTCAGACAGTTTGGTGCCAGTTCCAAGTTGCGTCATGACCAGGACCCAAGGTTCATGAGTGAAGTATTTT
CCCGATTCAGGGATTTGCTTGGCAGCAGACAGCGGGCAACCCTAGCTTACCACCCTCAGGCAAATGGCCAACAGGAACGGTCCGTCCAGACGGTGATTCG
CAGTGTCCGAGCCTACGTCGCTGAATCTGACCAGAGCGACTGGGACGAGCACGCTGAACGACTGATGTTTGCGCTCAATACGTCTTTTGATGCGACCACG
CTTGATACGCCGTTTTACTTGGTCCACGGTTGGGACGCTCAAGGGACGCTTTCAGCGATGCTCGGACCCTAGCCGTCGAGTGTGCCTGAGCGCAGCGCGT
ATGAGTGGCGTCGCAAGATGCAACATGATTACAGTTACGTTCAAGCCTGTGCGGAGGACCTGCAGAAGAAAGCGAAGAAATTACGTTCAGAGGTTCAGAC
CCTGAAATGGCAAGAATTGTCTGACCACATCAAGGCCGGGTTCAAGGTGGGAGACGCCGTCTGGCTCTACATACCCAAGGTTCAGCCAGGTCTGAGCAGG
AAGTTGGCTCACATGTGGCATGGCCCGTTCCGGATTGAAGAGATGCACGACAATTTTAGAGTCAAGCTCAAGGTGAAGGACACTGGTTATCGCGTGAACC
CCTGGGTGCACGTGAGCTGCTTGAAACCGCGAGCACTGTTTCCCAAATGTCCGACTGAAGAGGTGGAGGTAACTGAGAACAATGATTTCGATGCCGCCTT
ACTACCCGAGGACAACTGGGAGCCTGATGCTCTGAACGACGAATATGAAGTGGAGAAAATCTTGGATCTGCGTTGGGTCAAGCGCACTCGGGCCTCTCGA
CGCACTCAGGAGTACAAAGTCAAGTGGAAAGGATACGATGAACCAGTGGCTGCCAGTCACTCAGCTGAACTGCGGTGCCCTGCTGTATGCGTTCAACCAG
GGAGCTAAGGCGCGAGCCCGCTTCCAGGCCATGCAG