Description :
From Genome Similarity Track
Location :
Scaffold_1222:778- 3874
Sequence
3096 bases(100 bases per row)
CCCCGAAGTCCGTGTAATTCACTAATGACCTCCGAGAAAATGTTGGCGCTTCCTGACTCCACCATACCCCGCGATCGTTGAATTCCGGATTATGGTGATC
GGGTTCCGCGATCAGCGGTAGACGTGACCCCTGGTCCACTCGAAGAGTCAGCCTGATCAGCGTGTCGGAACTGGACTTAGACCTGTTCTATCACCACTTC
TCGAAGCCCAAGGGATACATATTCCCTGTCCAGCAGGGTAATCTTCGCACTCCTCCGAAATTTTCTTGGTCATCCCAGCTGATCACGTCCACCAAGATCA
ACCAGTTCTACGATCAGCAACCGTGGGACGTGTACGATCAGATCGTACGTCCGATCTCGTTCAAGCCTTCCGGATGGTTTGAAATCTGGTCGAGGCGTAT
GAAGCTTTCGTGGATTGTCATCGTCAAGCTCTATGGGAAGCATCACATTTCTTGTGGCTCTCCCCTGCGCAACGTAAATTGGATCCTGAGTTGGCTGCCT
TTGCGCAAGAAAGAAGGTAGAGACGATCTCGTGCTGGCCCCCGATGGAAAAGAGTGTTGCAGCTGATCCTGAATGGCATGATCGACGGTCTTTGTGATCT
GAACGTTTTGCTGGATCCCATGTTCCTGCACTTTCCCTGTCCGAACGAGGTTAGCGTGTGGTATCCCGGTCTTTCCGTGCAGCGGACCAACATACCCAAC
TTGATCACCGCTTTGTTGATCGATCATGCTGCCGAACGTTGGAGGAACCAGTTTCGTCCTTCGATCGCCTCCCACCCTGGGTCATCTCTTCCACGCTTTA
TGGGTAAGTTCTTTTTTCGCAAGTGATTTCTTTGGTCTAGTCCCATAACGCGATCTCTCAATATAATTTCGTCTCACTTCCATTCGATCGCTCCCATAAT
TCATTTCCTTCCCTTTCCTTTTACTTTTTTTCATCGCGATCACACCCTTGGTCTGCGATCATCGCACTCAATTCACATAAATTCCATTCCATCTCCATGT
ACAATCTCCTTGCACCCATTACGTCCATCCCCATCCATACAGCTTTCCTGCATATACACATCCACTCAATCTCTCCGATCGTCGCTAATCTCTGGCTTCT
TCTTCGTGCGATTGCATAACCTCGAAAAGGTTCCTGCTCAACCGATTGCAATTGAACTCCTGCATCATAGCTCCACAGTTCAGATCATCTTCGTCAATCC
AGGTTGGGTTGCAAACTCCTTCCATTGTATCAGGTACTGATTGTGTATTTGGCCATATCTAGTCTTCCGTCCCGATCGCACATCGATAATCTTATCCACT
ACAAATTCGTCGGCGTCAAGATCACCCTCCCAAATATCCCCCGGCAGCAGTGCTTCGTCAAAATCGAATCGACTTGCCTCATTCAGCCTACTCGTAGGGC
GTTCTGGGAACACGCGAACTAGCTTCAACTTAGAAACGTGATCATTGGGAATAGCCGGTGCGGTGTACCCGCGATTTCCAACTTTACGGCGTGATTGGCG
CACTTTCCGGCCACTCGGGAAGGTTTATGCCACGTATGGGCTAGCTTCCGAGCGTATCGTTCCTTGGCTCGGTCTAGATATAACCAAACTCGCAACCCGC
GATCGATATTCTATAAATCTCGATTTTCATTATGTCGATCGGCTCGACCTTTGATCGCAACCTTTGATCGGTCATTCACTACTGCCCACGCACGCTGATA
TTGGCGTTTATGCCATATCTCCACCTTCGTGCGTCTTGATCTCGGGGTTTAGTGCTTCCCAACGATAATGTTGCTTCCAAAGTTGATCTTGGGTCCCAAC
CGCGAATCCGGTAAAACCGTGTGTCTCCGCGAATTCAATCATGAGCGGTGTTGATCGCATAGGTCAATCGTTCTGCTTATTCGTCCCAGTCCTTTTAATT
TTCATCCATGACATACATCTTGATCGATCGAGTCAGTGTCTGCACCATGCGCTCGTCCGTACCATTCGCTTGTGGTCTATATTCCATGGTGGCCCGCCGT
TTTTGTCCCGCGATCCAATTGAACGCTCGGAAGAAATCGAACCTAAATTCCGGCTCGCGATCATGACATATCACCTCACTCGCACTGAATCGTCTGAGCA
CGTATTCTTCGTAATTTTCCGCGATCGTCTGTGCGGATCTGTACAAGCTTGCTTTCGCGATCACATACCCAGAAAATAAGTCGACCCACAATAACAACTC
GGTGTTATTTTTAAAAGATAGTGGCAACGAAGGGGTGTGATCCATAGCTATAATCTGGAACGGGTACGTCGATTGCAAATTACCAGGTGATCCACTCCGA
TCACCTGGTCGTCCTTTTCCGGTTTCACAATCCACACACTCTCCCACATACCGCTGCACACTTCGGTACAACCCACGCCAATGAAAGTTCGCCCTGACCC
GTTGATAAGTACGGTCGAATCCTTGATGACCACCCTCCAAACTTGTGTGGTAGTGGTACAAGAGATCTTGCTGTAGCTGCTCTGGAACTACCAGACGAGC
CAGTTCAGTACGGTCTTCCGATTCGGTGGCTGATCTCGGACAGAAAAATAGCAATCCACTTTGGTCTACTTCATAATCCGGTGCGACCAGGGCGCAAACT
TTGGCTTCAGCCGCCGATAATCTAGCCACATCTCCAACCAGATGTATCTTCAGACTGGATATCCAATTTTCTCCGTCTTGTGCTTGCTTAATGCGATCGA
TCCGTATCTGCTGCACCACCTCTTCCTGTAAAATTCTGGGCTGACAGCGACTTCTTAGGGCTGATCTAGTAATAGCCACCACTTTGACTGCATGATCGAC
TCGTTCTGGTAATAGTAATTCGCCTAGCCGATTGAGAGCGATCCGATCCTCATGATCCTGATCCGAAATCACAACAGTTCATTTCTCTTGCCGTAGACCT
GCACTCGCTAGCGGATCTGCACTCTGATCCCAATCACGCTTCATATGCAGGAATTCATGGGCTGGTCACGATCGGAGTTTATCCATCGCTTTATGTCTCA
GCAATTGCAGTCCTGGTGCCTTAAAATCGGTTTCTCCTCGCATTGGCGGATCACTAAATTCGAATCTCCGCAGATAATCACTGTCACCTGGCCTGA