Description :
From Genome Similarity Track
Location :
Scaffold_2889:778- 2281
Transcript NameFunction/comments
Phyta_totarag14910hypothetical protein PHYSODRAFT_249089

Sequence
1503 bases(100 bases per row)
TACTGTCGCGAGTCGTCCCGAAAGGGAGAGACAGTCAACACCGTATAGAAGTAGGAGCTAAAGACTGAGAAAACTTAAACAACAAGTCAAATAAAAAGGA
tattcaacttgctgccTTCCGGGAAAATACACGACTAACTATTCTTACGCTACCAAACTTTACGACGCTCCTCGCTTCACCGTTGCCTCTTCCTTCCGCC
GATCCGCTCCTCCTAGCAGTCATCAGCACGCCCGCATCTCGGTCATCATTGTTCACCCTTTCCTCTTGTAACAGAGATCTTGACGGTGCCGTCTGTCCGC
GCTATCCATCCTGCTATCAGCTCTCTCCTTAGCGTGGCCAGATCGCGACTGGTCAGgcgcagcaagcgccacTGTCTGCTAGCCCGATACGGGTCCACCC
GCGGGTCTAGCTCCTAATCAGCAACCTAATTTGGGCCGGGGCGCCTTGCCCGTCCCGCACGCGACTgggcgtcctgctcctcctcctaGATCTGATCTTC
AACTCCCGCGGGAGGACGGCCGTCTCCGTATCCGAGACGGTTGCCTCCGTTCTCACTCGGGACATTCTCCCGACCGTctctcggcgtcctcgtcgagaCT
CCTTCGCACGTATCTTGATCTGGAGAGCCCTTCTCTCAGCTTGTAGTCCACTCAGCGTTCGCACCGGTTCACGCGACGCAGGGTCCCCACCTCCTTCTGC
ACGCCAGAACGCTTCACTAAGCCGCTCAGCCTGCTCCTGTTCTTCCATCGCCAGCAACCAGGCCCCATAACCGTCCTCGGCCATCATCAAAGGGGACTGT
CCACCCGAAGTTGCCTCGAACCAACACCACAACTGGCTTACGACCCCAACTAATATCACCACGGCACTCGCCACGGCCGCATCCTTATCGAACACCACAC
GGTTGACGTCCTCTAGCCCTTCCTCCGTTGTAAATGGATAGttcaccgccagcagcaggacggcAACACCAGGCCATCCTCGGCATGCCCACTCAATAAT
CTCGTACAGGAACAGCATACCGTAGAACGCAGCGTAGCCCAGGAGAGACACAACCGTCCAAATGGCGCGACCGGCAAAGCAAGCCCGGTTGACAGTCCTC
CAGTACTCCATCTTCGAACCGGTCCAGTACTTTACGGTTGAGCGCCAACCGTATTCCAACGAGTTAGCAAGAAACACGCCCCAATATGAGTGAAAAGCAT
CAATCCACTTGTGGAGGAGATGCCCCACACCATCAAGGTGATCGCGCCTCGCTTCTagcaccaccaccggaaTGTCCCACAAAGCATCACAACTCTTCCA
CCACCTCTCACCACGAGGCAGGCCTTGCAAGGCCGGTTCTCGAACATACCGTCGGTACCTGCTGAGGCACATCTTCGCGAATCCAGCCCACTTATACACG
GAGTAACTCATAGCAGAGGACAGTCTGATCGCCACGGTACGGAGTGGTTGGGTAACCGTCCACACCAAGGCACCGGTCATTAGCCACAGTAGTTCACGCC
AGT