Description :
From Genome Similarity Track
Location :
Scaffold_473:778- 1833
Sequence
1055 bases(100 bases per row)
cgacccaaATCTAACGGAAACACCCCGTGGATGTCACTCCCGTGTGTTCTGGTCTGCAAAGATGTTTActatcaacagcaactaGTCTTACATGAAACGG
ATCGCTAAAAGTAGGCCACGGTGAACTTAATACTTTAATGACCACTAATTGTATTTTTACTCTTCGTTGTGTGCATTCTAAATGTGGTTCGTACAGAGAG
CTGAATCAACACGCATTATGATGTGGGGCTGCAAAGCAACGTGCgttgcacagaggaagaatAAGCAACTCATCGAGTCTATAGACTTCGTCTATCAGTT
GGAGTTCCGACGACTGTAACGTTCTTAGAAAAGAACCAAGTATAAGGATACTTAACAGTCCAACATTATCTATTTGGACTCGCAGAGTCAGTTAGTCTTT
AATTAAGTAACATTAAAATAACTATCTTATTTGCTCGCAAAATGTGAACTAAATTGGTTATTTTATCTGCGGCCTAGCCGTCTGATTCTAAATGTATGCG
ATTAACTATGCTATAGTTAATCATAATCAATATAAAATGAATGGCGTTGTGGACATACACTATTATTAGTACTGGCTTAAGCTGGCGAAAAGGATACCAT
ACACCACGACCGGACAAGTGGTCCAAGGTGTGGGGGGATCCTTCGTGTAGCCCCGTTACACCTGCAAATAATGGTCTACCAAAATAAGCTGCATTCGTTG
TACTCGTATGCGGAATAGCTCGTGTTTGTACTGAGAATGGTCGTCACGCATAGCTATTGGGCTATTCATGGCTATTACTACCGGTAGTGCTGTGCTTTGC
AGCTGATCTGCTAAGCTGGAAGTGGCTGTAATCCAAAGGATGAAATAAActaaaaagcaaaaatgtCCTTACAACATAAAGGTTAACTTTAGGCGGGTTA
GGGCGATTAGCTACTGGTGATCGAACTGACACTTCGAGAAACACCTTGGTCACTATAGGGGAGAACATTCTCCAGAGTGCTGGCGCAGCTTACCATACTA
GCTCATCCCTTGTTTGTATCGCTACTTAGGCCATTCCAACtgcaacaggaacgac