Description :
From Genome Similarity Track
Location :
scaffold_46:77787- 79110
Transcript NameFunction/comments
Plaha_PHALS_09893leucine carboxyl

Sequence
1323 bases(100 bases per row)
ATTTGTGACTGTGTGCTTTACCAATTTGTTTATCTGCGCAATTCTGCTGTGAGATGATTCACTTCAGCATTATGTTTTGTAGTCTCCTAGTGATAATGCA
CGAGCGCTCGAGCTTGAGGCCTTGTTACTAGCAACAACGACACAATAATGTGCTTGCAACATATGAAATTCTTCTAGCTCATCAAAGATCTCAAGTCTTT
CGCGTCTGATCACATCAACGCaccaaaataaaaataatggACCAAAGCCAAAAGAAATAGCACCACATGGTCATTTAACGTACCTGACGCGTTCAGATGG
ATCCAAATAGTGGTAGTAGACCTTGTTCATATCCCAGCACTGAGCCACTTCGTACTTGTTACTAGTAAATCTTGTAATCTGTGCTTCAATCGTTGGATAA
TCGTAAATACTCAGTAGATTACATCCGCGTGCATCAATGTTCGCCATCATCACCTTTCCAAATGCATCGTTGGGCAAGATTTGCTCGTACAATGCAAAGC
TCACATCGTCAAAGAAAGATCGGGCCCAGACTACAAACTGAGTGGAAAACTTGGCTTCCATGTAGATGAGCACGCATTCTGACACAAAAAGCGTCGGAAC
ACTGTGATCGATGCCAGCCATTTCCATTTTAGCTGTTGTAGCGTCCAGATCCCTTAAATCACAAGGAAGAAGGTGGTACCCTGGAACGTTTAGCTCTGTG
CAGTTTGAAGAGACTGCAGCCATGAAATCTGTAGGTGTACTAAGCTCTAAAGCTGCCATTAGCGGCTTACGACGCTTAATAGTGCTCACCTTTTGCATGG
TCACATCGGGAAAATCGAGCTCAAAGTACTCGCAATTGGCAAGTACCTCAGTGCTTTTTAAGCGAAAAAACATGGTATCAAGGCCTGCACCTAAGATAAC
TACCTGTTTCTTCGGTTGTTCTGTGGCTAAAAACTTTCGCACGAGCGTCTCAATAACAGCCACACGTGCATAATAGCCACGGTTGATGATAGGCATACGG
CGCGACGGCGCCTTCACAAAGAACTGGATAAAAGGGTCAACATAGTATCCCATCTGACAGGCTGAAAGTTTGCATAGCGATGCATCTGACGCTGTGTCGC
GCACGGCAACGTCGTGATCGGCGTCACTTGACGGAATACTCGCCATTCTCTAGACGTACGAGCTTAAGCTTGCGTGAAGCATCAATTTTTTACGCCGAAT
TGATTTAACACAGATAATATATTAGATTTACAGTATAATCTTTTTTATGAAATTTTCTCGCATTGTATGCGAACATTCACTTGGTTATCGTATCTTTTGT
GTGAATGTCTCTTTATAGAATTC