Description :
From Genome Similarity Track
Location :
Scaffold_174:77782- 79008
Transcript NameFunction/comments
Physo_144259hypothetical protein

Sequence
1226 bases(100 bases per row)
CACTTCCTCTGTGCATTGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCTACGCCTACGCGGGTAGATGGGTCTACCTGAATCCTCG
GTGGCTCAGGTCCGTGAGCCACGATGGACCGGAGTGAGTTTCCTCTCTTGACTGACCCGCAGTTCGAGTCAGTGCCGAAGATGGCGGGCATCTTCGGAAG
TGATGCCCTCCGGAGCTTGGCGCGGCGACGCCAGCCGAGCCGGTCGAGCGGATGAGCGCGTTTGACGAGTACGAACGCGGGCTCATCGCTCATGTGCAGG
GAAACCTGCTGGCTCAGATGAGTGAGCCCAAACGGGTGCAGCCTAAGCCTTTGCGGCTAACTGTGCCTCCATTCGAAGGGGAGGAAGATGAGAACCTTCA
CTTCTGGATCCGGGAGACCGAGATCGAGCGTAGGTCTCATCTCGGCTGAGAACCTTTGAGTCGCCTTTGCGCTCTCCAATCTTGGTGGACGTGCCAAGAC
TTGGGCGTACACGCGCGAAGCGATGTCGCCTGGATGTTTTACATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCTTTTCGCCCGGCGTACAACGAG
TTCCGCCAGCGCTCGAGCTTCCTTGCCTGCAAACAAGGGGAGCGCGAGCTATACGTGTACGTACAGGAGATGCGCACGTTGGCAGCCTCGCTAGTGGGGG
ACCCACTGTCGGAATACATCAAGATGACAGTGGCCTAAAGGTCGGTCCTGCGCGCACGCAGTTGTTCCGCGTGCGCACCGCCACTATGGAGGAGGAGATC
CAAGTCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTGGTGCTCTGGCTGTTGTACAGCCTGTGGTCACTGAAAGCGAGCCAGAACCCATGGATCTGA
GTTCAGCTGAGCAGTACTCAGTCCGCTGCTACGGCTGCGGCGGACTGGGACACTATCAACGTGCCTGCCCATCGTCAGGGTCTGGGAAGAAGACTACCCG
AAGACCAGAGGGTCAAGGGGGAGCCGACGCCATCCACCGTCAGGTGCTCAAGGGAGCCACAACCACCAGTAAGGACGAGGGCCTTGCTGGGGTTGGCCCG
AGTCTTTGTGATGGGTGTACGGAAGGCGTACACCACAGAGACCCGGGGTCCCTTGCGAGCACTGACGCTCGCTTTGGTGAAGAACAACGGTGGGTTGTCG
GTAGTACACGTGTGTGTACGGGGGTA