Description :
From Genome Similarity Track
Location :
Scaffold_49:777711- 781871
Transcript NameFunction/comments
Phyin_T30-4PITG_16801Putative uncharacterized protein

Sequence
4160 bases(100 bases per row)
ATGCTGCTGGAGAAGCCCGAGGACGTCAAGCACCAGAATTCGTCCGGCACCGGTACGTGCTCTCTATACTACCAAAAGTACTAGTCTAACTGACGACGTG
CTCGTAGTGGGGTATCTCTTTGCTGTGTTCTGACCTGCTAAAAAACTAATGCTTCACAGTGTGCGCCATCTATGGTGTGGACGCGCATCCGTCGCTGCTA
CTTTTTGCAACGGCAGGCGGAGACAACACAGTCAAAATTTGGTCGCTGCAGACACCACCAGAGGGAGGAATTGCCACCTTTGAGCTGCTGGCGACACTGG
CGAACCACCAACAGGCCGTCAACTGCGTGCGCTGGGCAGGCCACGGTCGCTATTTGGCCTCAGGGTCTGACGACCAGCTAGTGCTCCTCTACGAGCTACA
AGAAGGGAATCCAGCCCCTGTCCCTTTCGGTTTCAATGCAAGGCCCAACAAGCAGAACTGGGTGCGCTGTTCGACGCTCGAGAGACACACGATGGGTAAG
AGGAAGCTATGCTGGAGACTGGATAGATGTGGTGCTAATGCTGGTAACTGCTGCTCTTGTGCTGCAGATGTGGCGGACGTTGCCTGGTCGCCGGACGATC
GGATGTTGGCGACTTGCAGTATTGACAATACGATTTTGATCTGGGATGTTGGTGTGGGCGCAGTGAGCGAGGTCATGACGCAGCCGCTGCAGACGCTTAC
GGGACACAATGGGTGGGTTAAGGGCGTTGCCTGGGATCCTGTAGGCAAGGTGTGTCACTATGTAATGTAATATGGTGTTGAGTATATCTGACCGACACTT
GTTACAGTATCTTTCGAGTGCTGGAGAGGACAAGACGGTGCGGATGTGGAAAGTGGCTGACTGGCAGCAGTCCGACGTCGTGACGGCACCGTTTGAGGGA
TGTGCTTCCACTTCACACTTTCGTCGTCTTTCGTGGTCTCCTGATGGCTCGGTCCTCTGTGCTACTCACGCGTTCAGCTCCAAGAAAAACATCGCCTCTC
TGCTTAACCGCGGGTCCTGGACAAACGATCTGAACTTTGTGGGTCATCAGGGTGTTGTGACTAGTGCGCGATTCAATCCTAAATTACTGGGTGCGGTGAC
TAAGGGCCATGCACATACCGTCACGTTCTAATGATTTTATTGTTATAATGTTGCTCGGCAGAAACAAGGGCAGATCCGAAGAAGGAATTTGCATGTTGTG
CTGTGGGTGGCGAAGACGCAACTGTGAGCATTTGGCTGGCACATCTAGCACGCCCATTGGCGGTGATAAAGGATTGCTTTGACTCGTCAGTCACAGACCT
GGCGTGGTCTAGCTCCCAGTCACTTCTCCTCGCGTGCTCGCTCGATGGATCTATTTGTTGCTTTCAGTTCGCAGGTGACGAGATCGGCACCCCCATCTCG
GATGCGCAGCAGAGTAAGCTCATGCAGGCAAAGGTACGTATGTTGCAACGGTATTTTGTGTCATCTCGACTCTAAACACCCACTTTCATACGCTTGGCAT
AAAGTACGGATCTCGAGCTGGTATTACGCTTACATCGAGTCTTGTAGAGAATCCTATCCAACTTCAGGTACGTTCGTCTAATCTTGAGTCGTTGATGTGG
GACGAGGTGGCACATTCAATCGAATAATCTGTGTGATTAGCTTGAAGAAAAGTCAGCGACTTCACCACCGTTAGCTGTCGGTCAGAGCTCTGGAACAAGT
GCTGCTGCGGTTGTGACCCACACAACAAACACGCTCATTCCAAAGAAGAAGAAAAAACTTGGTGCGCAAGTACCGACTGCACAGCACAACAAAATATCAG
CTGGAACAACTACGAACTGTAACAAGCGGCTTGCTCCGGCATTCCTTCAAACTGACGCGCAGTCTTCAGCCAAGAATCCAGCTTCATCGCATTACAATAT
TCGCAATATCTTGGGGCCGACAATCGCGTCACCGACGGCATCGAATGCAACACTCTTGGACTCGCGCATGACGTCGACAAGTGGTGGAAAAGAGGTTATC
GTTGTGCCCAACACAAACAATTCGGCGAAGCTTCAGCCAAACTCTACGCCGAGTCGTAGCGAGATGGCAGGACCCTCCCTCAATGAAAAGCCCACGGCGC
CGAAGACAAACGTTACTCAGTTTAAACCGTCCAAAATGGAAGTGAAGAAATACGCGGTCGATGGAAGTTCTCTGAAGAGAAAACGAGAAGGCAAGCGCTC
TCCAGCTCACACCAGTTCTGTGGTTGCGAAGTCGAAGGAAATTGTGGCACGGCCTTCGAAGCTACTGAACGAAAGGTTAGCTAAATGCTATAAGGTTCAG
AATTGGTGCAGGTATTAACTTGCGCGCATTGTGCTTTACAGCAGTGCTGGTGTGGCCCGAGGGGGTCAGCTGCTTCCTGATTTCCCATTCAGACTACAGT
TCGTCCTAGAAATCGAGACAAGCGCACAATCCAGTAGTTCAAACTCCCCCTTGAACAGCAGAGCAGGAAGTGGCTTGGTATCTTCTAAAGCGGTGGTAGA
AGTTATTGTTCACAACCTGAAGAATTGTCAGCCGGAAGAAATAATAGGTGAGTGCAGCAATTGTAATCTATCCAGCTAATGATCTCTAATTTTGACAATT
GACAATGCAAAACAGAGCTTGGCCCAGTTTATTCAACTATTAAATGCTCCGAGGGAAGCGAAGTCAAGTGGATCGACCGCATTCCTGGTCGAATCGTGTG
TGCAGTGGGAAATGCAAGCTATTGTGCAATTGGTGTACATAACGGAGACCTTCTCGTTCTCAACAGTAGCGGACGGCGACTATTACCTGTGATTGGTATG
TATACCAGCTTTTGTTTGTGATCACTCAGATAGGTACGTGTACTAACGTTCGCCACGTTGTTCAACACCAGCTTTGGGCAGTGCCATCTCAGTAATGGAG
TGCAGCGCAAGCGAGTCGCCCTATCTATTGGTAATCCTGGCCACAGGTGATCTCAAAATCTGGAATCTAGCGGATCGCAAGCTTATACTATCAAGCTCCG
TTGAGGCAATTGCAAATGTAAGTTAGCCTCCTTTAATTTTGTTACTTCTTAATAAGGAAAAGTTGTACCTGATTTTTACCATGTGCTGTGTCGGAAGATC
ATGCCAGAAGACCATCGCAAGTTGACACTTCTCCGGTGTCAAGTGACAACCAGAGGAATGCCGCTTATCACGTTTGCCGAGTCCAACTTGGAAACGAAAG
GCAATTCCAGCTTGCTTTCATACACATTTGACGCTGGCATGTCGTCATGGTACGGGCTTTGCAATGAAGAGTTTTACCTTTTTTTTGTAGTAAATTTGAT
CTCTAAATCATGCTTTGATGTAGGATGCGAGTGGCGGACGATAGCTTCGTCTTCTCGGACTTTGCGTCTACTCTACCTACAGACGCCGTCACAGTTAAAA
GTGTTCCTGTACATTATTATATGATCCGGCTTGGCCAGTTAGTTATCTATTAACTTACCTCTGCGATTTGCATCGGTAGATTGGGCCATTACGACGACTC
CAAAACGCGTCTGGCTACAGCCGAACAAAGAGAGGAATTACTTCAGCAATGCTTTCGGGTATGTCGGACCCGCTGATGCAGCGCAACGTGACACGCTCGC
ATCTCGAACACCAGGTTGCTGCCGCAATTGTCCTGAAAAGTTCAGCTGAGTATCGTTATTGGTACGTCCAGGTTCTTGCACAGTCGATTAAAACCTATTG
CTGATACTTTCTGAAATAATTTATAGGATACAGGCATACGCTAGGTTCCTCACGCATGACGAGGATGTAATTCGCCTTGACGACCTCTGCGCTGAAATGA
TTGGCCCCTTTCACGCGTAAGTCTGTGGTCAATATAGAAACCTTTCTCGCGACACTAAGCCCACGTGTTGTATTCTGTAGGTCATCGTTGCCGATTACAA
CGGAGGCTAAGAACTTGGATGAAAGTGGCGAGTGGGAGTCGATGATCCTGGTACGTTTTTGTTAGCAACGGCCAAAATCGCCATTGTGCCCCAAAAACTA
ATTCAGCGCGGTTTTAAATTCAGGACTTGGTAAAACGGGACGTGTTGAAGTTACACATCCTGCCCACAATCGCAGCGAATCGCGCGTTGCAGCGTGTCGT
GACCAAGTACCAACTCATGCTGAGCGAGATTGAAGCTCGTGAGAAGACCGAAGAAGACGA