Description :
From Genome Similarity Track
Location :
Scaffold_28:7777- 44754
Transcript NameFunction/comments
Phypl_g1137conserved hypothetical protein
Phypl_g1138hypothetical protein
Phypl_g1139conserved hypothetical protein
Phypl_g1140hypothetical protein
Phypl_g1141hypothetical protein
Phypl_g1142hypothetical protein
Phypl_g1143hypothetical protein PHYSODRAFT_361023
Phypl_g1144conserved hypothetical protein
Phypl_g1145hypothetical protein PHYSODRAFT_316158
Phypl_g1146hypothetical protein
Phypl_g1147hypothetical protein PHYSODRAFT_508417
Phypl_g1148hypothetical protein PHYSODRAFT_504907
Phypl_g1149hypothetical protein PHYSODRAFT_505690
Phypl_g1150cyclin-H, putative
Phypl_g1151hypothetical protein

Sequence
36977 bases(100 bases per row)
GCTTCAAGCCAAGAAGCACCAGCGCGACAGAATGCCAGCATGAAAGTTGCGAAAAAGGTGAAGAACGCACGGGAGATGATTGTGCCTAACGCAgcggagg
agaagcaacCTCCGAGCGGGAAGAAATCTGCGGCAGGACTGGGACATATTCTGGGCGATGATGATAGTTCCGAAAGCCCTGACCAAGGTATTGCCGAACT
GCTCGATCTGGAAGACTTGGACGCAGTTGAGGAAGGGGGCAGCGATATgagcagtgacgaagagTTTGATCCCTAAATTCTGCCAACTACTCCAGACAGC
GTTCACTTGTCTGTGCAACCTGATTAGTCGGGGACGGAGCCATCTTCGAGTTCGCCAGATTCAACCGACGAGGTGGTAGACTGATCAACGAGTTGGCTGC
GGAAATTTGCATGAGCTTTCATCTAGGTGTATCCAGGAAAAGGTGCAAGCATTAGTATTTTGTTTACGAGAGCGTAAGGCACCAAATAGCTCCGTGAAAA
ACGTACCAGTGCCGGAAGCTCCCCGGATTCAACGGAGCTGTGTAGATTGTCATCGTCGCTCACGCTCTCCACCACATTTAAGGCTTTGTTCTTGTGTTTT
ACGTACCTTCTCTTGCATTCGCCAAATATTTCCCCATCACTTAAGTCCAAAGCTTCTTCCCGCGATAGCTCACCCTCTGATAGCTCTGCGCTACAAATTG
AAACGGGAACGCTGCTCCCAGAAACAGATAAACGTCTTATACGTCGGGACGGACGTTGACGTTGAGAACTGGCGCGAAGCTGGTGACGATCAATCTCTCG
ATAGATTCCATAAATGTGATGATAGTCCTGGCTGGAACTGAGGCCACTGCTACTAACTGAAATACTCCTCGCAACGTCGAGGATACTTTCATCACTCGCA
GAGTCATCGAGGTGCAGAATCTTTTGAGTGAGATGCTCTGCCATCGGTAAAGCCACCGAATCACGCTTTTCGTGTTTGTGGTGGTGATGATCTTGCTCCA
CACTTCTCGATGAAAAGCTTTCATCCGCTTCTTCAGAGGAAAATACGCTCTCTCCGTCCCACAGATCGATGTACGTATCATTTGCGTCTTCACCACGGCC
TGAAACACTTACCCCTGAGCTAGCTTTTGCTGGTTCGTCCAGGCATGAACGTGTTTGCTGTCTATTGAGCATGCTTTGGTGCGTCCGCCTCTGCTGACGG
AGTCGCTGCAAAATGTCAATCGATGTGACAGGATGGAACAATTTGTGCGAACCATTGTCATCCTGCTCAGCACCACTGAGTGCATTTGCAATCGCTCTAC
CAAGATGCGTTTGGGGAAGGCACGTTGAGAGAGGAAGTGCGGCACCTGCTGGACTCGAGACCACTACATCTTCATGATTCACCtcaggagcagcaacgat
TAAATCTGCAGTGGTGCTTGCAGATCCCGCTTGATAATCCCCATCCAAAGCTCGTACAGCCTTATCAGTGAGTATTGCGGGAACTGAAAGTTCCTTCATG
TCTGTCGCTTCATTGATCCATCTCACAGTCGGATCCTCTGGCATTTCTGTGCGTTCTTCGACATGTACGTCTTCCACAGGTACCGCGGACATATGCCGAA
GGCTAGCAGCTTGCCTGTCCTTCCAAATCTGTTGCACCAAGCCACTTACTTGCTCTTCCGTGAGTACGTCAGCCCAATTGACCAAATCATCGGAGCTCGA
GTCTTCAGCTACGGAGCAGGGTTCACCATCACCTTGCGTCATTTGCTCATTGTAgtaagctgcagctcttttTAAGCCAGTGATATCTTCTGTGTCGTCC
TGGTTCAAGGCCCCGATGTTTCGTAGCTGCTCTCTGATCAGCTCTTGAGTGATTTCGCTCACGATCTTGTCGTCGACTGCTTCCTTCCCAACAAGCAATT
CCAAGCTTTTTCGCACGACATTCTCCCTGGCTTCGACACTAGCTGCGCTGGCAGTATCCCCGAGTATCCTGCTGACCAAGAAATCTGGAATTTCCTTAAT
CACCCTGTCCTCAATTGCTGCTTCTCCCTGCTCAAGGTTAACTTCATaaactcgagcgtcttcttctcttgGATGTACATACCGGCTTGCTCTTGGCGAG
CGTGTTGGATGCGCATATATTGGCAAGGATGTCGATGGTGCGGACAGCTGTGCGACCGTGTCGTGTTCCTCCTTCCACACTTTATGCCGCGTAGGAGCTC
GACTACGTTGCGCTCttcgctgttgctgctggtcataTGCAGCGGTGACAAAGGCCACAAACTCCTTATAGTTGATCACTTCCTTCATCGGTAGATGCTG
GGTATGGCGGCTTCGCGCACCTTTTGCATCGGACGAGTGGATATGGCGAAAGAACGATATGATTTTCGTAGTCGGAACGGAAATTCGCAAGCGATGGAGG
GCCATGCACGTTTCGATACGATTCACGTGGCCATCTTTGTCGGCATCCAAGTCGCTAAAAAGGCGTCGAAGAACGTCCGCATTCAAACGCATGTCTCCTG
GGTTCCCCATAGTCCCCGAAAGTATCGGCTGCGCGCCAAATGAAGCTACCGACGGCATGGTGCGGAAATCTGACAAAACTTGTCTCCCAATGGATGACGA
CGCGCGCTCTTCAGCTGGCGTCTTCGCTCGACGAGGACTACTTTCTTCAATCGCAAACATATCATCAGCCACACTATCTTGGTGAACATTGGCGGCTGTG
TCTTTCTCATTCGTGAAAATATCGTCCGTCAGAGGCCTTGGAGCTTGACGAGGACTTTCAGATTTTGCTTCTGCGGGCTGACGTAATACAGTGTTGCTAG
TCGCTTCGAGATCATCCGCAGAATCTCTAGGCTTGCTCTCCTTCATTTCCTCTTCAGACACTGGTAGACCATCGTGTGACTCACCTGGCACCTTTTTGAC
GGCTGTTGAATCCCTCCACAATGGCGACTCTTTCGAATTGCCCACTGCAAACTGCGCTCCAGCCTGCGCTCGGGTTGCTGCATTCGGCTTCATGTTCTCC
TTATCCTCAGTGGCctcgacgccaccacgaactgGGCTTGTGGCCACGTGCTTGGTCACCCGCCCAACTCCACCGTCCGTCTCTGCAGCAACCTTTGGCT
TCGTCCAACCCTTTTTCTCCTGCTGATTGACGGCGGACGTGTCAGGGACCCCACTCTTCGCCCGTCCTGCTGTAGCCTTCACGACAGCCTTCCTCTGACC
CCCAACTCCATCAGATTTCCATTGAACGTCCGCCCTCCTCGCTCCACTGGCACGTTGTCTGTAGGCTGCAGAAGTGTGAGATGACGTGGGCTCCTTCCTC
GTGTGGTTCCAGAATCTCTGCGCGGGCGgatactgctgcagctctcggtCGACTCGGGCGATGCGTCTCGCCACCTCCCACTCCATGCGGCGCTTGTACC
GCCGACTGACCTGCAGACCCGACTGTCCCTCGAGAGCCAAGAGCATTTGTTCCGCTtcgcccgccgccgactGTTCCGCTGGCAGTCCGCCTCCGCCCCG
CCGCCTTCTGGGTCCGGCGGCGCTCGTCATCACCAGCGCGTTGTTCGTCCAGAGCAgtggcaagctgctgcgcagtctcgcctgcagctcgcggttGCGG
GCGGTCacgtcgctcagcagcgcgtagccGGCGTCGAGGCTCTCCATCGCGCAGCAAGATCGGGATTGggaccacttcaacgtgggcAGCGACGTTTAGC
GCTAGTACCGGTAATACCGATGACGGAGGCGTCGTCACCGATTCGTTTGCATTTCTCTGCGTTCCGATCCCAAATCCAACGCATGTTTATCGACGATCGA
ACATGCACTGCCTGTACGATGCACGTGTCTGCAGACACCTTGCCAGGAATTggttggcggcggcgctcatggCAAACAACGCGCCAAGCGCATTTTGTCG
CCAAACGTCGCGGACACACCGCCGCTTACCGGTACATTTCCTCCGCGCTGATTGGCCGTCGTGTCTTTGTGGCACACATACCGTCCGATCTGCCATCACC
GCCTCGGAGCCGTCGGTTGCGaccaaagcagcagcagccagcacctCCCGGCGTCATGTTGAGGAcgacgcagcgcgcgcgccgccttcctgcCGCGCGG
TCCGCGCTCAccagcgtccgcagcagcagcagcgaccgcctCCCGCGCCTGTCCGACCTGGTGCTCATCCGCCacggcgagagcgagggcAACGTGGCCC
GCCAGCGCTCCCTGGCCGGCGACCACAGCCTGTTCGCCGGCGAGTTCAAGCACCGCCACAGCTCCAACTGGCGGCTCACGGACCGGGGCCGGAGAcaggc
cgcggccgccggcGACTGGCTGAGGCGCAACAACCTCGCGCACTTCGACCGCTACCTCGTGTCCGAGTATCTGCGCGCCATGGAGACGGCCGGCCGCATG
GGGCTGCCCGGCGCGCGCTGGTACGCCGAGATGCTCATCCGCGAGCGCGACTGGGGCGCCATGGACCTCATgagcgagcaggagcgcttcgtcaagatgc
aggacgagctcaagcggcgGGAGCTCAACCGCTTCTACTACGCTCCGCCAGGAGGCGAATCGTTGGCCGCGGTGGCGCAACGGGCCGACCGGTTGCTCGG
CATCTTGAACCACGAGTGCCATGACAAACGGGCTATTGTGGTGGCCCATGGAGAAGTGATCTGGGCCATGCGCACCAGGCTCGAGAGAATGTCGCAGGAT
ACGTTCATTGAGCTGCAGGAGTCGGGGCGCATGGTGGACCAGATCCACAATGGCCACATCTTGCACTACACCAGGAGGGACCCGCTGACTGGCAAGATGG
CGCCATTCTTCACGCATGTGCGGTCGGTGTGCCCCTGGAACGAGAAGCTCAGTCCCAAGGGATGGATGAAGATTGACCGACCAGTGTATgacaacgagct
gctgctggctaCGGCGGAGCGTGTTCCGCGAATGATTATTTCAGAGGAGTATCTAGAGAAGACGTACAATGGAGCCAAGGTGTTGTCGGAGGGAGATATC
ACCCCGGATGTGCTGTCGCacagcacgagcttgaaTCAGGCTTCAGCATCCACCGAGGcgcccaccaccacgaaAGCTTCGTCGAAGAAGGAAGAGCGGC
AGACGCCTCTTCTTATCCCTGGGAGGCCCATGGTGAACCTGAAGAAGGTGGTTgtggtgaagaagacgtctcgcttccagcacgaagctgaGCTGTACGG
CAATAATGGGTACGTTTTGCACTCTATCGTAGTATGGATGCTATGCTTGTTCACAGTTCTGATTTCTTTTTATTGTCACGTCTGGTATTGCGATGCATCC
GATATCCAGTGAAGCTTTGAGGAAGCAGATGTCAATGCGAGGATTTGTCCATGACCGCTTGAAGGCGAGCCATGAACATCACATCGAGGCCGTGGATGAA
ATTACCAACAGGTGCAGTAGAACTTGAGAATATGCGTGAATTTTGTTGTCGCTTCACTGACTTTGTTTTGATTGTTGGATAACATAGTTTTAAGGAGCGT
GACATCGACGTGAAGGTTGTATCAGCCAACCAACTCACACACGAAGCAGTAGAGGGGACGGACATGATTTTTTCTGCCGGGGGTGATGGTACTTTCTTGA
AGACCGCAAGCTTTGTAAACACTCCGATCCCAGTGGCAGGCCTGAATACAGATCCTAAGCGGAGCGAAGGAAACCTGTGCTGCTACAAGGTGAATAACGT
TACCCACCGTTTCAGTACTGCGTTGGACCGTTTACTGGAGGGCGACTTCAAGTGGCGACTGCGCCAGCGGATTCGTGTCGGTATGGTAAACCAGGATGGC
TACTGGTACGAACTGCCTCGCTACGCTTTGAACGAAGTGTTCATAGCAGAAAGCGATGCCTCTCGCCCATCGCACTACAATATCGGTAtcgaccagcacc
agcgcgaaTCCCACCGTAGCAGTGGTATTCTGATGTGCACGGGCACAGGTTCGAGCGCATGGTACTCCAGTGCGGTACGTCCAATTGAGGCTGCATCCTA
CTGAACAATCTACGAATACTGACTAACATTTGTCTATGTGAATAGTGCCAAATTTATCGAGAGCAGGTGGCAAATGTTCTCAGCGCTATGGACCACACAC
ACACGAACGAAACAGTGACGGAGCTGACAGAATCGTAAGTTTTTATGCTCTCGACTTCAGGTTTTAGTCGGAAATATTATGGAACTAACGCTGGCGCTTg
tcgtgctgcgctgctcaCAGTATTAACAAGCAGAACGTTTTCCCGGAGGATTCGCGGGACATGGGCTACATTGTCCGCGAGCCGATTATTAATGCTACGT
TCGGTGATATCAGGTTTAGACGGTGAGTTCATCTCGCTTGGCTAGAACACCTTTTAGATAGAGTGTGTTAACACCCGCTGATACTGTTTTCTTTCTTTCT
GACTGCAGAGGCAAAGCTCGCCGAGTGTCCATGCGGTCCCTTGGATGGGATATGAAAGTCAACATAGATGGTATTTACTCGGTGCCCCTAGATTACGGCG
TCCAGGCGGTCATGAAGATTGTGGACGAGCCAAAATACGTGCTGCGCACCGTGGACTTCTCCCCGCTGCCAGGCTCAGCACCCAAGAAGAACATCTTTTA
GACTATTCAGCGGCTAGCAATCAGTTTTGGACATGTCAATACTAATTCGACTCCACGACGTCTTGAGTTCCCATTTTTATTATCGAGCAGATTTTTTTTT
GCAGCCATCCACGATATTATCTGCGGGTTCGCGAGCGTGATCTCGATGACGAGTACGAGTGGTGACGGTATCGCGAAAATCTTCCGGATGATCGTCCTTC
GTGGGAGCGAGACCCCGACCGGGAACGCGACGAAGATGTTGAGCGTCGCCTACTATTCCGTCGACTGTGGTGTCCCCTCTCACGTCCACGAGATGGCGAT
CGGCTATCACTGCGActacgtcgacgacgagattgAGACCCACGGCGGTCGTGATGCGAATGACGTGACTCGCGCGGTGGACTCGCGTCCCTGATCTTGT
GTTCTCTCGAGTGTGCGCGCTCCCGtggtggagatcgacgacgcGAGTTTGAGTGCTCTGGTCGCTTCcgatcctcctcctctcgtGTCGAACCACGACC
GCGGATCGACCGTGCTACTAACTCTTCGAAAACCTGCTTCTGCCTTTGCTCCGGTAGTAGCGCGGCCGACTCACCACtggacgctgcagagctATAGAAC
TCACGGACAAGCTTCTGAACTTCATCGCTCTCCCATCGCATCGTCGTCTTGTCTTGAGTAGACAGTTTATCCTCCAGGAACTTGGTGATACGTAGCTCCT
CGCCATCTCGCTTGAGCGCTTCAGAGTTAAATTCTGCTACCGCTTTGGCATAAATCTTTTCTTGAGCAGAGAAGGTCAACAGGCCCAGTGCATCGTCTAG
GAGCTGCTTGTATCGCTCCGAGTCAAGATGGTTCTCCAGTGTCGAAAGGAATACGCCGAGTGAAGTGCTTGGCTCACACGAATCAAGCTGAAACTGTTCG
CGCAGTAGCTCCGTGAACCGTTTCTTCGCctgcttcaacttgctcttcttctccgccttcATATCCCCTCGACGGTGCTCTACAAAATGCTCAAAAATGG
CACGGCGCTCGTCCATCGTCGGCACGCCCATAAAGCGCGGATCACCAGCAATCTGTGGCAGCGCCACCGACCACTTGCAGAAAGGCATGATGTTCTTGTC
ACGCAACATGGCTCGGAACTGCTCCATCCGCTTCTGTTCACGAGCTTTGCGCTCCTCTTCCGCTTGCAATTCCTCCGCTGTCAACggctcttcctcctgc
ttttcctcttgagctgctggttcttcCTGCGTTGCCCCCGCCTCCACCTGTTCGTCTCGCTTCTCCCTGTGCTTCCTGTGTTTTCGTcgttttttcttct
cgtccttcgtcttctgcgcttcctcttcttgaaGTTTCCTCGCCACCTCAGCGATCCTCTCCCTCTCACGctcctctgcagcagcggcctcCGCCGCGCC
CCATTCGCTCGGTCGCTCCCACACCGACTCGCGTGTGCTGGCGTTAAAGTAGTACAACGTGCCGTTGCCCGCGTCGTGCGCCGTCCAAATGCCCGAGCGA
GCCACGGCGTTCTGCAGCATGAGCTTCATCATGAACACGGtctcgagcgacgcgagGTCGGTGGGCGTCTCCCATCGCGACGAGTCCGTCTTGCGGTCGT
AGTAGAAGAGCCgcccgtcgccgtcgtcgtgcacgGACCAGTCGCCCACCACCTTCAGCGCATTCAGCACGTACATCTTCTGCTCCGCCGTCATGACGAC
GTCGCTAGGcgaaggtggaggcggcggcggcgccatggAGAGCTCCTGGTCACCCATGTTTGCCTTCCTGGTTGAAATGCGTGTTCAATACACTACATTC
GTGTACGGAACACAAACGGCATCAGCTCCTGCCATTGCGGACCAGAATCAGACCAAGAGATGTCGGTGGTGCAGACGCCCAAGCGCCGCTTTGAGACCGA
CGAGgagtacgaggaggagcagctgctgctggacctggagacggagctccagcaggtgcaggcTCTCAAGGCACAGACGCAGCAACGCCTGagccagctg
ctgcaggacgagaagcacctagagcagcagcagcggcgtctaCAGCGCCAAAGCGACCGACgagacgccggcgccgccactgcgcgcatgctgcagctgc
aggaaaAGGAGCGGGAGCGgctcgtggcggcggaggccaaGCGAGCGCgggaggagcaggaggccaagggCAGGGCcgaggaggcgcagcgccgtcggGA
GAACGCCATCGAGACGCAGGGCGGCGACCTGGAGGACCTCGACGCGTTCCTGGCGCAGGATGCTGCCCAATTCTGAGGTGGCGCCGTATGGTCGTTTTGA
ATATTTATTGGTGGAGAATGTAAGTGCTGCCTGCCAGGAAGGAAGTTGCCCCTTCGGTTGTTGTTGCCTTTGTGCAGGTTGTGCGCCACCGATGAAGGAG
ACTGTGGGCGCCGCCGAAAGATCATCTGAGATCTGAGATCGCCGATCTCTCTCCTCCGCTGGTCGACATACGCCGAGCGCTTCTCGGCAGCAGACGGAGT
TAGCGGCTCcatggaggacgcggagCCCAGGAGGTCCGCCACTAACTGCTAGACGTTGGAGACTGAgagctccgactcggagccTCCGAGTTGTCCCTCA
GCATCTTATTCTCTCGGCCACATCTGGTGGCCTCGGCCGTGCAAGTCTCCAACGCGGCAGAAGCTGAGTCGGGTCGGAGCCCTCTGGACTCAGtctgccg
ccgtcgcggccAGATGGCGGAGAGGCTGtcaaccacttcaacatcagcTCGCCCTCCAAGCCGGCGGCCCGCCGTGATCAACTAACTAACTACGCCGGCG
AGCGTTTTCGTCGGCACTGGGGCTCGGTGCTCGAGGCGCCTCTGCGAAATAATGTGGCCAGTTGCGGTGAGAAGGCCTCTTTCGCGCCCTCACCAAGGAC
AGGCTCATGCCCGCGCGGCCTTCCTTTTTCGAAGGGCAGCGCCCGAAGGTGTCGGCTCCCGTGCCTGGATGCCGAGTCAGTTCCGAGGGAACGGCGGTGG
AAATGGACAACGCCACGATTGGCCGAAAACCCTTCTCGCGCGTCGTGGATTGGCCGAAAAGATTCCGCCTGAGTTTTCCCCCTGGCCCAGCCATGAGTGA
GAGAGCGAGGCCAAACAGCGAGCTGCCCCGAACCCGCGAGCAGAGTGACCACAACGCAAAAAGGAAAGGAGTGCGCGAGTGATATCCGGACAAAGCGCGT
TGACTCACGCGAAGAACGCCCGCACCGCCGCGCATATCCGCCCaaaagccccccccccctcccttTCCCCCTTACTCGAGAGACCTTCACTCCTTCCCGC
GCACTCGTCCATGGAGACCGCCACCCCCAAGGACGTGACCGACGCGGGCaaccgcaagcgcaagatgACGGCCACCACGCCGCCGTCCGGCCTCAAGCGC
GGCCACAAGCTGTCGCGGCCGGCCGCAGCCGCGGGCGCCAGCGTGTCCAACGGCGTGACGCCGCCCGTGCTCACGCCACAGGGCTCCATCCACACGTCCG
AGCAGTGCATCGACCACCAGCGCGCCATGTTCAGCGCCCCCACGCCGCACGGGCCCGTGGATCAGATGCCGGCCACGCCCGCCTTCGTCAACCGCAACGG
CTTCAGCCACACACCTGacggcttctcctccacgcccagcgacgGCTTCCCGTCCAACAGCGCTACGGGGCAGCAAGCATCCACGCCCGCGGACGACAAG
AACCAGACGGCTGACGCTGCTAGCGGCCACTCGTCGCACGCGcccacgccgtcgcccgtGCCCCGCGCGGCGCCGCTCAACCTCCGAAACTTTGCCAACT
GGGACGTCGGCAGCCGCTACACGCTCGTGCGGCTGCTCGGCAAGGGATCGTACGGACAGGTACGAACAGCCTCTCACGAGTCCTCTTGTGGTCTGTGTTT
GGGGTTCTGATATGAGATCTTCAACCTTTTGTTCTTCTCTTGGTCCGTTCTATTctgcaggtggccgaggcctTCGACAACGAAcgccagaagaaggtgg
ccatcaagaagatcatCAACGTCTTTGACCAGGAGATCGATTGCAAGCGGCTGTACCGCGAGATCTACATCTTGCGCCGTCTGAGGTTTGTAGAGGCTTT
CAAGCCACTAACTGTACTTTTTGTTAGTGAGCACAAGTGTGCTGACCGGTGGTTTCTGTATGTCCGTCCACTTGCAGCCACTCGCAAGTGATCAACTTGA
TCGATGTGATCCCGCCAGACAACTACGATACCTTTACGGATCTGTACCTGGTGTTCGATTTCGTCGACACGGACCTGCACAAGCTCATTATGAGCCCGCA
GTACTTGACCATCCGCCACATCCAGGTCTTCCTGTACCAGCTTTTGTGCGGGCTGAAGTACATTCACTCGGCCAACGTGATCCACCGTGATATGAAGCCC
GCCAACATCCTGCTGAACGAAGACTGCACCCTTATGGTAAGTGGCCACAACCGGGACACTTTGCTCAACGGTCTCTAATTTTTCGACTGCATGATTTTCA
TAATTCCAGATTTGCGACTTCGGGCTCTCTCGTGTCATGGAGAGCGACATGTCGATGGAAGAGCTGAGCAAGCACTTGTACTCACCGAAGGACTCCAAGT
CGCCCACCACGTCTGACGGAGGAACCACATCGGCGCCGTCCCCTGGAAGCGCTTCCTCTACGCCTTCATCGTCCGGCGAATTCCCGAAGATGCGGCGGCA
GTTGACGAAGCACGTTGTCACGCGATGGTACCGGGCTCCGGAGCTCATTCTCCTTCAGGATTACGATTTCTCTGTCGATATGTGGAGCGTGGGATGCATT
TttgccgagctgctgagcatgCAAGTTGAGAGCTGCCCGCGGTACCAGGAGCGTGTGCCCCTTTTCCCTGGCCGCTCGTGCTTCCCTCTTAGCGCAGACC
GTCCCACGACGTACTCGGAcaagctggaccagctcAACGTGATTTTTAACGTGATTGGCACGCCTGGCGAAGATGACATTGGCAGCTTGGGCGAAGTCAA
GCAATACTTGCGGAAGCTGCCTAAGAAGGATCCCAGGGACCTTCGCGAGGTATGATGAAGTGGAGTTTGTACCAAAAAAACTTATACTGACCCTCTACTT
TGTTTTACTTCCCCGCTAGATGTACCCGGGCGCCCCTGCTGATTCGCTTGACTTGCTCAAGCAAATGCTGTCATTTAACCCCGAGTGCCGAATTTCGGTA
AGCGTCCCTCTTGCAGTCAAACTCGGCATTTTTCTTGGGGTATATCTGACCGATTTCTTTGTGTATTAGGTCGACAAAGCGCTTGCGCATCCGTTCCTCG
AGTCAGTACGGAGGTCTCAGTCCGAGACTGTAGAATCCAACCCGTTTGGTATGGAGTTCGAAAACGTCCCCCTGAACAAGGAGGCTTTGAAAGGTATGTT
GAATTGCAATTTGATACTTAGGCGGCTATAACTGCGTGAGGCTGATGCGATCTGCTGTGTTGAAATGTGCAGCCCGTATTTTTGAGGAAATCAAATTGTT
CGCGGATCGTAACAACCGGAGATGAAAGAAGTCTTCTGCTCTGTTCGACCGCGATGGGACGAGCCTCTCCCTGCTCCGTTTTCGGCTTGCGCGCATGAAG
ATGGAATCGGGAGAAGTGGTGAACGAACAAACGGCCGGTGTTCGCAGTTGGTGATTGTCGGCTAGTTTGAGTATGTACAATGTGAGGAAAGGAGGCAAGA
ACGAAATGGCGTGTGGACCACAATGAACTACCAAGTCAAATGGTGAACTGTCTATAGAGACGACTGACTCCTCGAAGAGAAGAGGAGCCTAGTGCAAGCC
AGCCCGTATTGGTTGTATGAGCGCGTACGTTCGTTCTTGTGGCCTTACGAAGCATAAtgacaagaagaaccagACCGAAGAACAAAACGGAGGGTCGAGA
GTAATAGTAAGTGGTTGCCCGTTTTCGCCTACACGCACAGTCGGcaacgctgctgccttgGGCAAGCGTTGCCGACTGTGCGTGTCTGTTGTTGGCTTGT
CTTACGTTTCGATTGCAGTGTCGAATGTGTTTTCAAATAGATGAAGAAAATAGACCCAGGTGGCGTTGGTGGCGTTGGCGCTCGTTACAGCTTTATTTTT
GCATTCCTAGTCAACGGAGTGTTGTTTCAAAACGGATATTGAAGTGCTCACAGGCCCATGGGATTGACGACAGCTACTCGCTGAACGGCAAACCAATGCT
AAGCCAACGACATACTGGTTGGAGCTCGCTGTGCTTTCCTGACACTGCCGAAGCTAAGGTATATCATCACTCGCTTGCGTTTATACAACCCCATGGAGAC
CAGCGTGGACACCCTCGTCTATCAATtagaggacgacgacaacaacgtACGATGGAAAACGTTGCAGAAGCTTCGGAAAATTGCAGCAGTGGAAACCTCT
CACTTCCCCGTTCGCAATACGCGACGCTTTCTGCAATGCGTTCGTCGGCGTATTGTTGGCGAAGCGGATCTTAATGTGGCTGTTGAAGCGTTGAGGTTGC
TAGGAGATGTGATGATCTCGCTCGGAGATAGCGTAGACCAAATCCTGACGTCCATCCTGCCGCACTTGATCCCAATCCTaccgaagaagcgcaagaaccA
TGAGCAAGACGGGGATAGTGACGGGGAATCGGATTCACTCCATGAAGAGATGTTTCAGGTATTTCGGAAGTACACGAACGTCACAAACGATCTGCAAGCT
GTcgcggatctgctcgtcAATATCGGTCTAGGAAGTGGTCATGGATCGGTGCGTGAAGCCACGCTCATCGTGTTGATGCGACTACTGGACGAGCGATTCC
TGAAGCGCACAATGACCAGAAGTGCGATTGGTCGAGGGGACAAGGCACTTATCGTCGCCCTGGTGCAAGCAATCATACCAGCGTTGGAAGACGCGAACGA
AAAAGTGGTCGTAGCTGCCGAGGAAGCTATCGCCAAACTTGAGTCGTACTGGGGCAGTCGCTTCTCCACCGACGTGATGACGTTTCTAAGCAGCGAAGAC
AAGCAAACGCTGAAGGAGCACCAAGAGCCGATCACAGACTTCTTGCAGGTATGCACGGCCTCTGCATCGCCACCCGCTTCACCGCCACAGTCACCACGAC
CGACTTCTGCTACATCATCGTCCAGTAACGCGCGCGAGGAACTGAGTAACGATACCACATCACGACTTTCTCCTTCGAAAGTTCACCCCCTGGATTTGAC
TGCTGATCTACGCTTTGGCTTCTTGAAAGCTAGTATCGTGACGACACTAACGACCAACACGAGCAACTCGAATGCAGACTGGAAGAAGCGGGCGGCAGCC
GTAGAAAAGCTCTACGCAGCCTGCAAGGAGGTGGATGAAGCTGCACTCTGTGGACTTACAGCTGATGAGCGGGCTAAACGtatggacgagctggaggagc
taTTCGACATTTTGGTTCGTCTTACACAAGACGTCGACGTTCATCTCGTGAAACGAGCACTTCAGATCACTCAGATACTATTCCGCAAGCTGAGCCCCCT
GCGACAGCTTGATACTAATGACACACAgagtgaagacgatgacgagaACAAGGAGTCTGACGACCGGCACTCTAGGAGCAGAGGCCAAAAGGATGCAGCC
TTCTACATGACAAAGATGCTAGCCCCCATGATTGAAACTGCAGCTAACTttgctggagatgacgatGAAATGGAGAGTTTCGTGTATACCCTGCTAGGGC
AAGTCTTTGAAAGCGGGTGCGTTAGCGTGTCCTTAATCGAGCAAGTTCTAGCATCGACTTCACTTCGGCATCGCCGTTCTCAAGTTCGAGAGGAAACGGC
GAAAGTTTGGCTGGTGCTTCTTCTGATCGCGGACCGTGGGGGTCTTCTCTCAGCAAATTACGCACCGAACGAATTTGTCGTGCAGACGCTCGGACGCTTG
CTCGGTGACACGAGCGCACGCGTCCGTGATGTAGCTTTCGAAGTGACTGCCGTGCTCGCAATGGTATGCTGCTGCAATATTTATGCATTGCTGGAGACCT
TTATTGACGATGAATATGTCTCCGAGCGTGTGGATTGGGCAGCATTGAGGGCGAGATTGCGGCGAAAGCAAGTCCCGGAACTTCGATCTAACTGCACGCT
GCGAATAAAGGCAACGGTCACTGCTAGAAACGGAAGCACAAGCCGATCGGGTCGACTTTCTTCAAGTGTAGAGCAATCCCTTGATGGAGTCTCGGAGCTG
AGGATGATGGTGGCAAACAATGGCCTGAAGTCCTCTGGAAATCACCGACATGATACTCTAACGAACGAACCAGCCAGCCTTGTGAAGAGTAAAGTGATAA
CCGGAGGAAGTCGCAGTGATCGCCCGTACTTTGATCAAGAAGAGACTGGCATCGATGGTGGTGATGCTAGTTGTAGGACAACGATCAGCGAAGAAGGTCC
CACGACTGTCGATATCAACGATAAGCTTTGTGCTTTGAGAAAGAAAATGGACCAACTCCGCCAACCTCGTATCAACCGAGTACGGCGCCCCAACAGTCAA
GAAGAAGTGCTTACAACAGCGAAGACCGCGCGAGGACATGATCACACGACAGACCCAAAGCTGCCACGATCGAAAAGTTCACCGGAACAATCCACTAACA
ACGCTGCCGACGATACCGATGCTCCAATTCAAAGCAAGGAGGAAACTTTTCACCAGTCCCCGAGAGAAAAACGCGTCCACCCGAACAGGATGGCGGTTGC
CTTACCAACACCAGAAGCATTCACATCTTCACCCCGGCAGCCGACCGAGCTGAGCCCTCAGCAGCTACAAAGCCTGCAAAGTGATGCACGGAACTACGAA
GATCGCCCTCTAAAGTCCAAGTTTATCGGGAGACAGAGAGAGCTGGGAAATGATGCAGGAAGTTTGTCTCCAGCACAGGCTTCGCCCCTTGAACGTCCTA
TTCGTCCGATGGCCACAGCAGGCGATCCTCCTCATATTGACCTAAACTTTGTGGATCAAGAGAGCCCCAGAGAGTTTGACAACAATGACACTCGATCGAC
ACGGACAAATAATGGGGAGCGTGTGGTGTCCTTAGCAACTCGAAAACGGCtggaggcgaaggcgaaaCAAGATGCCCAAGCTAGTCCTGGAAGTCCTACA
ACCGAGCGGGTGCGAGCACGTGAAAATAACACCCcgacgtcgaggaagaagccaGCAAAGGCCAAAGGTGCAGTGGATGACCTTGACACGAAAGCACGAC
CTTCTGGCAAGCAGGAACCGCGATACTTGGAGGTGCACGAGATCGCGCCACTGCTGAATCCGAAACAGGATTTGAGCAAAGCTCTCTCTCAGCTTCGAAG
TGATGACTGGGAGGCCAACTTCGACGCGCTGAGCACAGTTCGGCGACTTGCGACGCATCACGCAGGCCTGATGGACACTGGCAAGGTGCACGCGATCGTG
TCTGAGATTCTGAAGCAGATCCCGAACTTGCGTTCATCAGTCTCCAAGAATGCGCTTTTGGCACTGGAGTCCATGTGCGCAGCTTTCAGTCGGACGATGG
ACTCGGAGGTGGAAAATATCATTCCAGTCTTGCTGAAGCGCTGTACGGACTCGAACGCTTTTGTGTGCGAGTCCGCAGCATCTTCGCTACACGCGGTCAT
CCTCAAGTGCTCCACTTCTCGCGTCGTTGCTGCGTTGGGGTCCCTGGTGAGCAGCAAGGCTGCTCCGATCCGCCGAGAAGTGGCGCGTGGCATCCACGCA
GTCATCGCTTGCCAGGCTGACAACATCCAAGCAAGCAAGGACCTGCCTTCAATCCTTCAACTGGTCGGCCGCTGCCTTGAAGACTCGAACAACGAGGTGC
GCGACGTCGCAAAGCAGTCTGTCGTGTACTTGCACTACACGCAGCGCGTGTCTGGCGAGCGGATCAAGAGGTTTTTGTCTGTATCGGCACAGGCGAAAGT
CGACGGTGTTCTAAGTGGCAAGGTCGCGTATGCCCCCCCGGTGATCCCCACACCTCGCAGCGTATCTGATGTCGCATCGGAtcgctcttcatcgcctcTT
GCCCCCATCAAGAAACGGGAGCCACCCGCAGTTCCCCCCAGAGCGAAGAAGACTACGAAACAACCTTCAATTcggacgtcgtcgcctctATCGAGCAGCG
GAAGTCGATCGAAGATCAACCCTGGCGAAATGCTTCGGCTCGAGACGAAGCTGGGCAGTAGCAACTGGAAGGACCGCTTTGACGCGCTTACCGAGACGAC
GGACTTTATCTGTGGCTGTGCATCGGCTCTCACCGACAGCGGCCAGATGCTGAATCTGTTCGACCAGCTCATCAAGCGTCTAGACGACGGCAACGCCAAG
GTAAACGTCCTTGCGCTGGAATgcatggagaagatcgtccCCGCCATGGGCAGTGGGATGGAGCAGGTGATGCCCAACTTCGTGCCTGCGATCACCAAGA
ACCTCGCCAACGCCCGGACGGCGTCTCTGGCCCAGtccgtggtgcagcagctttgcGCGCACACGGACAGCCGCCCGCtgtgccagcagctcgcggccCA
AGCTCGCAGCGCCAACTCGCGCGTGGTCCCAGTGCTGCTCGACACGCTCACGCAGCTGGTAGCGCAGAGCGTCGACGACAAGAGCAGCTACGTGCTCAGT
CGTCACGTACTGCCCttggcgctggacctgctgaaGGAAGCCAAGAGCGGCGTGAGAGACGCAAACTCGAGGCtactgcggcagctccggcggACGCTAG
GACCCGCCGCAGTAtcgagcgccgcgtccaAGCTGAGCTCTGCGCAGCAAGACAAGCTGGCAGGTGTGCTACGATGACCAGGACTCGACTTCAAGTTAGT
ATCAAACTGCAACACCTGCAACTAATGACAACTAGTGACTTGGAGCAGTCACATAGACCGGACGAAACTGGTGTGTGCAACAACATACGCAACTGAAGTT
TTTAGCGCAACCTAAAGTCGTTTGAATTTTGCGCGCGCGCCATCTTGGCAACGTGGTGGTCCATTCTTCTATCAGCAACCTTCAAGCCGAAGGCTTCGTG
CACGTTAGAGAGAGCGTCAAGCCCATGTCGACCACGCcgcagaagcaggagacgCATGAGATgcacgaggagcaggagcagacgTCGTCTCCCCCCACGC
CCCCGTCGGTGGAGAACCAGACGCAAGACACCGAGACGGGGGAGGAAGCCATGGccaccaaggacgaggagcacgagcacaAGGAAGAGAAGCttcagga
agaagaagacgagaagacgcaggaggaggaagtgCAGTCGCCTGCAAAGGCTTCGACAcccgtggccaagaagacgctgtcggccTCCACGTCAGCCACC
AAGAGGAAGTTCGACGCCCTCCACGCGCGCAACGCGGCGGGGGACGCTTCCATCTCGGAGcacgagaagaacaagaaggcTCGGGCCTCAGCTTTGATGA
AGACGCCGGGCACGAAGAAGGCTCCGACCAAGACGAGGGACTTCTCCTTTGCCAGACCGACAGCGTCTTCCGCCAGTCGTACAGCTGCCCTCGCTAGGGA
CCAGGCCaaggcgacgccgacgcctccGCCCGTCCGCAAGCCGCTGCATCCCAAGCGCACGCCTGCTAAGGTCCCACGTGCGTCGGAGCCGGCGCCCAGG
ACTCCCGCGATGACGGACAAGGCGTCGCGCCCTCACGTTAGCTACACGCCGTACACTGGCCCGTTGCCGCCCTTGACCGTCGAATCCAGCTTTGCACCCA
AGGGCTCGCAGATCTTGGACCGTGGAGCGCGCACAGCGTCTCCTGCCAAGTCGAGAatggctgcagcggcttgcaAGCCCCGTCCGGcgtcggcgaagaa
ggcaaagcCGCAGGGCACGACCGGTAAGGAAAACAATGGGGTGACCACGGAGGGAGGGGCAGCTACTAACGCTGCTGCCAGTATCAAGGCAAGCCGAACC
CCCATCAAGTCCAGCACAACTGGATCGCCCGTGAGCAAGGAGCAGAACCGATCGGCgttcgaggagaaggccaaggcccAGCTCTTGGCTTCACAGCAGG
CTGCGAGTCCCGTGTCGACGCCCGCCGAGACTGTGGAACCCACGGTATAGCCACACCGCAACACTGTTGTAAGACCCCCCCTCTCCCCATATATATCGAG
CGCCATCCTTAGTTTGCGCTCCAATTTCATCTTTTAACTGCTCCACGGGGGCACGCGAAATAATGAAATGTGTTGCCGTTCTCTTTTCTTAGCGTCGACA
CAAATACTCCAAAGGTGGTCCCGTTAGACAGACAAGAATTCCTTCGTCCAAGCACGGAGCAAGACCATTTTTGATCGCTGATGGCGCCATCACCTCCGAA
GAACTCGATTCGTCACCAAGTGGAGCAGCGGGTTCTGCCTACACGGCCAAGTACCACACCCAGGACTACCAGCAGTGTGCGTGACAAAGCTCTGCACCTG
GACGATGACACTTGTGGACCTTCGCATCGCCGAAAGTGGAGACGGCTAAGCAAAGGCAGACAAGAGCGAGTTCAGTGGCACCAGTCGCGAGCATTTTTCA
TCGTTTTactggtggtgctggtcgtgtgCTtaagctggacgtgctggttgatgctgctgactGTAGCGCCCAACGAGGCAATCAATTACGTTATGCGGAC
CCAGGAGCTCGACAACGGTTCATTCTGGATGTTAGTGGAGCCTACGCCTTCACTTCGAGCACTTAGCCTAGCTGGACTAGCAATTGTGGTGCTGGGGTAC
ATCTACATTGGCGTCATGCTTCTTGCCTGGCAAAGACAGCGAATTTCGACTGGCATTCCTTCCGTTAGCAAGCTATCAGTGGATTTCCAAGTCTTTTCCT
CGCCAGATCTCCGCCAACTTTGCAGTGGAAGCAAACGTTCTGTAAATCCATTAGCTTCGATCCATCCCGAGCAACCTGAGACACAAGCATCCAGATTACC
GAGTCtgagcaagtgcagcgaTGCCCGAAAGATAGTGGTGAGTATTTGCTCAACACTTTTCACGCTGTACACTCGTTTTTTACTGACTCTGGAATGACCA
GTGTCTCTGGATGAAAGTTGTAGACTTAATGCTACAACTCTTCATGCTGTACCAAACACTTGAGGGGGGCTTCCCACTACCTCTCGTTGTAGCGTGCACC
TTGATAGTCGTGTGGAATGCCTTTGCGGTCGTAGCGCTCATGCACTCACCCTCTCCACCATCTCAAATGAGCGAAGCTGTTGTGGATTCAATGTACGTAC
AGTGTGTGATCGCACCAGAGGAGTGGAAGTACCAAAACTAAACTCGTTGTTCTGTACAGCTCGGATTTTCTGGTAGCGGTTGGCTTTCCCGTGCTTGTTC
TTAGCTATTGCCTCACCACCTTCGAATATGACCGCTCAAGCCAGCGTCTTACTGCGGATCTGTTTCCTCGCTCGTCGTTCCAAAATGCGGCGAGGGTGCA
CGCAGATCCAGAGCAGATTGCTAAAGTCTTTAAAAGTCTCGAAGGTCTGCGCTTTCAGTCGGTTGGTGCCTGCATCGCTCGCATTGGGAATAACGTCGCG
CTGCTCATCAGTCTTCGACGCCTGATAAGGTTTCTCCGAGCTCAAGGACCCCCAGCTGCGGAACTGAAAGTGAAGAGCAGCATCTATCCACGAAAACATC
CCCTTgcactgctgctcgtggcgaTTGCTCTGGGTACTGTCATCTTCGTTTCAGGGAGTGTACATCGTTCGCGCAATGTGTGCCGAGAGTTCCCAATGTG
CACAATGCACGCATACCGTTGGTGGATTTCCAACACCAAGACAAACGAGTCAGAGAGTTGGAACTGCCCGTGCCGAGTACTAATCGATGTTGACGTATCG
CCGGCAAACTTTTCAACCTGGAAGGACCCGCTGGATGCCACTGCAGTTGTATCTaagctcgcggcggcgggtgATCTGGAGATCCTACAGGTAATAAACC
GACGACTGCCTGAACTACCTGACACTTTACGCCGATGTTCTCGTCTAAAGCACTTGTACGTTGACATTAGCGTGAAAGAGTGACTGCAACTTGAAAAGTA
ACTAACCTTTCGTTCTGCTCATTCCAGAGCTTTGGTATTCACGCATACGACCACATTGCCGCATTGGGCCTCCGAGTTCACGGACCTTGAATTCTTGCAT
GTCGAGGGCAAGGCGCGGGAGACGAGTCTTTCATCTTTACCCCAAGGGCTATTCAGcaacatgaagaagctcacgttTGTGCACTTGGGCGAGCACGTGA
ACCTATCCAGATTGCCCGACGTTGCTGGTCTCACCAACCTCAGATCCATTACGATGGCAAACCTAGAAGCATTGGACACATTACCTGCGGACTTCGCACA
GCTGACTCGCCTCGAAATCTTGCTTGTCGTGATGATGCCAAGGCTCGAGACTTTCCCCGATCTTACGCGAGCTCGCCGGACACTGAAAACCCTCGTGATT
GACATGTGTCGTCTTTGCTGTGATGGTTTCTTGCAGAGTGACTGTGATctaagcagcagcacttgcagacAGCCAAATGAAGCGCTTGTTTGCTTGTCAC
CAGGGCTTACAGCCACCACAGGGACGCTTGAACTCTTCCAGACTTTCAACTCGACTATATGCGTGGAGCACTCAGGACCTAATGGCAACCAGACTGGTCC
CGGGGGATGTCCACCCGATCACGGTACGCCACACTTTCCAGCTATGCCTTCCGATGCCGAACTCGAGGCAGCTCTCGAACAGAGTATGCAGCAGTGTGCA
GGTGTTCTGTATCGTGAGTGTCAAGTGGAACCCGCCCCAGACAGACCGAATTCGCCAAGTTTGAGCTCGGGGATATGCTACAGTGACCGGTACTTGCCTA
TATCGTGTAATGGAGACCCTAGCACTATCGAATTGCGACGCCAGCAGATTAAGCGGCACATTGGACCAGTGTGCAACCCCCAGTACGAGGCGTGGCTAGG
CTGTCATTCCTCATGAGTGCCAAGTTGCTTCCGactaaaaaaaaacaaaGCGGGAATATATGATGTCCATCAAGATGCAGTCACCGCAGCACGCCTCGTA
ATTGCTAGTGTTCGCCTTCACTCCTCCGGTGCTGGTGACGGAAACGTAAAACTCAGCAGTGCTTCGCCGATACCAAACTACCCGACCACGTTCGAACTAC
TTGGCCAACATCGTGTCAAGGTACTGGGCCACCTTGTCCCCAATGCGCCCCAGCTTTTTCGCTTCCTGGCCGCTGCTCACCGCCACGTCAGCATCCCGCA
GTCGGCGTGCGGCTCGAAGGAACGCAGTGCCTCGTCCCGTGTGGCGCTTGTACAGCTCCTCTTCGCCGTACTCGACTAGGGCATCCACCAAAATCTGGTT
CTTCTTGACTTGAGCTCGCTTACTGACAACGTCCTGCACGATAGGGGGCACCACCGAGTCGCGCTCACGCTCGCCGTATTCACTCGCCTCCTCTTGTTGc
tccacctcggcgtcgtactcgtagtcttcgtcactgtcgGCGTGCCCTTGATCGATGATCTGGTCGATCTTGGCAGCAATACGTTGTCCAACCATCCCGA
TCACCTGGCTCGCTTGCTTCCCCGACGTCACcaccgagtccgagtccCGGATgccttgcgctgctcgcaAGTGCGAGATGCCCTTGCCCCGGTGGCCAGA
GTACAAGTGGCTATCGCCGTAGTCGACCAACGCATCGACGATCGACTGGTTCTCGGGACACTTGGCAGGCTTCTCGCGCAGGTCCTGGACAATTGGAGCA
AGCGTATAGCCACCACCACTGCCACGCGAGTAGCTTCGAGACCCCGCGGTCTCGCCCATGTCCTTCACGATGCGTCCGTGCTGCAAGATCTGGTCAATCT
TGTCCGCGATCACGTCACCGACAAGTGACACGCTGGTCCGCGCGGTCGAACCCGACTTGATCACGTGTTCTGTGAGTTGAATctcgcgcgctgctcggag
GTGGCTCGTGCCCTTGCCAGAGCTGCCAAAGTAGAGTTCATGCTCTCCAAACTTGGTCAACTCGTCCACAAGCGGCTGGTTCTCGGGGCACTTGGCTTGA
GACTTGCagatctccagcaccagctcggGTCGCTGGTGGttgtccaccttctcgctcACGTTTTGATCGCCGGTCGCGTCTTTCAGCTTTCCGGTCGCCA
GCACTTGCTCGATCTGGGAAGCAATCTTGCTGCCCACCATCGGGACAGCTCGTGCATCCTGCGCCGACGTGATGGCATCCGGATGGTCGCGAATGTGGAT
AGCGGCGCGAAGATGCGAGACCCCCTTGCCCGTGTGTCCGTGGTCGAGTTGCTCCTCACCGTACGTGGCGAACGCATCCACGATCTTCTGGTTCGCACGG
TTTGCAGCTTTCTTTTCGCGAACTTCCTCCACGAGACGGATAGTCTTGTGCGGGGCCATCGactcctcttcttcctcgccggACACGGCTGCGTACGCGT
ACCCTGCGGAGGCcggctcgttctcgtcgccaCCATTTTCACCCCCacgcttgctcttcttgtgGCTCTGGTTCGATTCCGGCGGGAGGGATCGTTTGTT
GCGGCCAAACTTTgccgtcaccttcttcatgGCAGCCTGCGAAGCAACACAAACATTAGTTAAGCCATGGTATCCTTGGTAGCACGAGTGGACGTGACGA
CATCAATTTTTACCTGTTCGTCTCCGTTCGACGCCAAAAGGGCTGTGGCGAACTCCTGTGTGGCCGCGTAGGGGTTCTAACGCAACAACAATGAGTTGGT
TTACGTCCACACATGAAGGAATTTGACCATAAGCTTTACCTCTGGGATATCGACGTTCTTGCCCTTAGCCATTTCGTGCATCTTCCCGATTTGCGTGTAG
ACCGAGTCGGCTGTCTTTGCATCGGTCATGGTCACTTCACCAAATGCTTTCGCTTTCTACTTGTGCGTTGGTTGTTTCCGCAAAAAAAGGAGAATGAGAC
GATGTCCCGAGAATCCCGAGAACGGCTTTTGTACTGGAGTGTGAGACGTAGGCACCAAAGATGTCACCGTTAGCCAAAGCTTCAAGCGAGACAAGGGGGA
TTCACCAACATGAATACCATACACAGAAGAAATTGCCCAAGAAAATCGTACCACGAGAAAAAAATGAGACGTGGGTTTCCAACTGCCTTGAGTCTGTCGC
CTTCAATTGCGTCGCATTCGTCACCTTGTTCTTTGACTTGAAAGTCTCCTGAGTATCACTGGAAAATGCTGCAAACTACAAAACTATTGCAAACAGAAAG
GTCAAGCAAGACACCGGCGTCCCTACTTTTCGCTTGTTTCGGTGGCCTTCGCACCATCGTCGCTCGACGACTTGAACATCACCATCGTGTCGATGAAGGT
CACCACTTTGTCTCCGATGCCGCCGAATGCTTTCGCCACACTGCCACTTGTCACCAACACGACCGCATCACGAAggcgacgcgcagcacgcaTGAACGCC
GTTCCTCGCGCCGTGTgccacttggccagctgcaTTTCTCCATGCGCTGAGAGCGCGTCCACAAGTCCCTGGTTCCCCTCGAGTTGAGCTGGCTTACTGC
GGACTTCGTGCACGATCGGAGGCGTATCGAACGGCTCGCGGACGCCAAACTCGCTCCCTTCCTCgccctgctcgtcgtcgtcgtcttgatCGCTGTCAAT
GTGGTCATTCTTCAAAAAGAGTTCAATTTTCGCGCCCACTTGAGCTCCAACTTGCTTGATCGCCTCCATAGCCTGCTCACCCGACGTCACCTCTACGTCT
GCATCGCGAATGGCTTTCGCTGCGCGCAAGTGGGTAATTCCTCTGCCTCGATGTCCCGAATGCAGGTGGCTGTCGCCATAGTCGAGCAGCGCATCAACAA
TGGGCTGGTTTGcagatcgcgctgcaggatTCACCCGGAGATCCGTCACAATCGGGGCAACGCGAATGCCAGCACTTGAGCTTGGGACATCGTGAACAAT
GCGCCCATGCTTGAGAATCTGATCAATTTTGTCAGCGATGGCCGGCCCCACTAGCGGGACCACACGACGAGCCTCATCTCCGGACATGACAATTGTATCG
GTCCGTTgcagcgcttgagcagcgcgaaggTGTGTCGTGCCCTTGCTACCGCTGCGGAAGTAGAGCTCATGCTCCCCAAAATTCGCAAGTTCGTCGACTA
ACTTTTGGTTCTCTTGACGTTTTGCCTTGGCGTTGCGCACCTCGAGCACCAATCTTGGCGGTTtgtgcttctcctcgtcttGGGAGCTTACGTTCAACCA
CGGAGTTTTGTCTTCCAGCTTGCCCGAGAGCAAGATCTGCTCGATTTGAGTGGCCATCTTCGGCCCAACTAGGTGAACAGCTCGCGCTTCCTTGCCACAA
GTTATGGCGTGCGGGTAGTCACGAAttgcgcgcgctgctcgcagGTGGGTGACGCCTTTACCCGTGTGTCCtcggtgaagctgctgctcgccgtaGTCTG
CGAACGCGTTCACAATCGTTTGATTCGAAGCGACAACCGCAGGTTTGTTGCGAACACCTTCCGCCAAGCGATACAACTTTTGGGGCGGTTcctctccatc
ttcttcctcttctcccTCCAAGTCCATTGGTGTCTCCTTTTTAACGTCGTCATTGCCATAGATGTGAGCGAATTCGGTCCCAGGGCTTCGCTTCGCACCG
GTAGTTAGCACTAACGCGGAATGCTCTCGCTTGGTCCCCCGTTTGAACTTttcggccagcagcttcatggcTTCCTAAGAGAGAGAACCAAGACACGGTC
ATGTTAGATATTAGGTAGCCTCTACCACGCCCGAGCAAGACATTGCTGACCTCGTTGCCATCAGATACTGATAGAGCCGTTGAAATCTCGGCAGAAACAT
CGTAGACATTCTACAGCCAACACGAGAAGAAATACGTAAAAAGTTAGAGAACTACACGCGTGTGCTATCGTGCCATCACGCAAATCTACCTCAGGAAGAG
CAACTCCGCTTAGCTTGCAGGCCTCGCGCAAGTTGCCAAGGTGCTGGTACATTAGCGTAAACTCCTCGTCAACCATGCTTTCTTTGGTGTTAATTCATCT
GTGTCTAGTGAAATCCCAGCGCTGGATGCTTCCTCTTGCGACGGGTGTGTGTGAAGTTCGTGTCGCCGTTGAGTTCTTTTCTTTCTCGCCTTATCTCATA
GCGCCCACACGCAACTTGAAGCCGCAAGTGCAGATCCGTTAAAATGCAAGCCAgacgcgtggacgacgtcctAGCGGAGTTTACCGGGTTTGGAGCGGCG
TATTTGCGTGCCATTGAGAGTTCACGGGCTGATCGTATCGTTAACGATCCTTTCGCGGGTCTTCTGACGCAGCAGGACGGCGCAGAGATGGAAACAAATC
TGCGAACGACGTCAAAAGCTGGTAGTTCATGGGGAGACTTGATCGCCATTCGCTCCCGGTATGTGGATGAAGCACTGGAACACCGCGATACCAGTATCCG
CCAAATTGTGATTCTCGGTGCGGGTCTGGACACGCGAGCGTATCGTTTGGATTCACTGCGTGGATGCCACATTCTGGCAATTGACCAAAGCTGCCAAGCT
TTCGATCGCTTGAGTGAGGTGATGAAGAGGCAGGACGCGCCACCAATTGCAGACAAAGTTAACTGCATCGCTGCGAACCTCGCCGAGGACGACTGGGACA
GCAAGTTGCTAGCCCACGGATTCGACCCGCGTTCCCCCATTTTCTGGGTCATGGTAGGCCTCCTCCCGTACCTGGAACGCTCGAGTATTTTGACGTTGCT
GGACACAATCGATGGTGTGTCGGCTCCTGGCAGTGAACTCTGGGCTGACATGGCTGGCCAGGCAACGTTCACTTTTGCGGGGACTGCGTCCGTCACGATG
AAATACTCGGAGGATGACCCTCTCCATGGTGTTCTGAGTAAGATTCCTTGGGGTCTGACAATGCAGGCCTCACTGGAGAATGAAGGGACCCACTTTGGGC
GCAAGTGGACACCGCTGACTTGCATCGACACCGACAAGAACGTCCCAATTGCGTTCATTACGGGCAAGAAACCTGTTCCAACTGAAGCGCAGCTGAAGGA
CGTGTGGACTGGTAAGTTTCCGTTCACCAAGTAACACATTTAATCAGCCATTACGGCGAGAAATCCACATCCATCATTCATACATTTATGGGAAAGTGCA
CGACTGCGTTGTTCGTTGGCTTGAAGAGATTCACAACAGATTTTGCTCGCTGGGGGAACAACAAGTGGCTGAACCATCGCTGTGGCAATGAAAcctgctt
catcttcgccgtTATTCCAAGTTGACGCCCCCGTAGTGGACGACGCCTTCGCTGAGTCCATGGGCTTTGTGACAGCGTACCTACGAGCGGTTGAGAGTGC
TCGTAATGACTCGATCATCAACGATCCCTTCGCCGAGCCGCTTActcgcaagcagcagcccaagaTCGAGAAATTCATGAAAGATGTTTCGAGTGAGCTA
TCGTCCACTTTGCCAAACATCATCGCGTTCCGGACGCGTTATCTGGACGAAGCACTTCTTCACCGCGACCCGCGAATCCTCCAAATTGTCATTCTTGGCG
CCGGTCTGGATGCTCGCGCCTACCGTTTGGAGTCGCTCCGCGGTTGTCACATTCTGGAAGTCGACCAAAGTGGTGACGTCTTCGAGCACAAGGCCCAAGT
GATGATGGAGATGCACGCGCCACTCATCGCCCAGAATGTGGACTGCATCGTCTCGAATTTGGCCGAGGCTGGACTGGAAGCAAACTTGATGGGGCACGGA
TTCAACCCGACCATGCCAACGTTTTGGGTCATGGAAGGACTGATCCCGTACCTGGAGCGCTCGAGAATCGTGGAACTACTGAAGACTATCGACTATCTCT
CGGCCCCCGGAAGTGAATTTTGGGCGGATATTCCAGGACAGACTTTTGTCGACAGCGAAGAGTGGGGGAAGCGCGTTATGAAGCACGGTGAGGACGACCC
GTTGCATGGAGTTTGTAGCGAGATCAAGTGGACGCTAGAGGTGCAGGCGTCGCTGAAAACTGCTGGAGAGCATTTCGGTCGCCACTGTACCCCAATGCTT
TCACCCAAGACCAAGCAGGCAGTTCCgtacttcttcgtcgtcgccaagaagccgatTCCGGGTGCGGTAGTGGAGCAAAATATTTGCCCCGGTCTCGGAC
TAGTCACGGTCTAGTTTCGTTCGTGCACAGCTCCCGATTGTGCTTCAAAATTTCCTTTTCTTTTCGAAGCGGTTGAATACCGAATATAAGCACACGACTC
GTTCACTTTTGACTTCCATCCTTCGAGCATCACCAACTTCCCACGCAGACACGCCGTATGCGTTATTACCAAACTGGGCGAAACCTCTGCCCTGCCTCTT
GAAGTCACCTCGAGAAGCGTTATGCGATCATCGTGCGTTGTCGCGAGTAGAAGTGCTCATTGGCGCAACTCCGTGTTGAAAAAGTGCGTTGGAGCGCCGA
TCCAAGAATTCAATCTGTATGATAATGATAAAGCACCAATGGCTTGGGCATTCCTGACCTCGATCAGTCGAGAAATCTCCAAGTTCCTACCAGTAAAATG
GAAAATGTCAAATGGTGAAGGAGAAGTATCAGCGTTGACTTCATTGTCGCAACCAGCACAGCAGATTGTCCACTTTCTGCGGCACTCCGTCTGCTCCATG
CTCTTTTGGATTGCAGTAGGGGCTGCCATCGCCTCAATGTTGCTCACGGCGACCATGAACCAGAACGATCTTCATGACTACAAGAACGTGTCCACAGTGG
ACATTCAAGCCAACAAAGGTGCCGGATGGTATCTCGGCGGGATCGATCCCGAACACGTTTTAACGTTACTGCCAGAAATCCGTTCGTTTGACGACGCTCC
CGAAAATTGGGACTGGCGTGACTACAACGGCACGGGCATCAGTCTCACGACGAGTGCGTTGAACCAAATGGTTCCTCGCGCTTGCGGATCCTGCTGGGCC
TTCGCAACTATCAGCGCGCTGTCGGATCGGATCCGCATCGCCAAATTCAAGAAGACCGGTCGGCTAGAGGCAGAAGTCCTGCTATCGCCTCAAGTGCTGC
TTGATTGTGGAATGCGCTCTTACGGTTCCTGCCGTGGCGGGGATCCCCGGTACGCACACAAGTGGATTTACGAAAACGGTATCGTGGATTTGACGTGTAG
TCCGTATATTGCCTCACACCCGTCGTGGATCGGCAGTGGAGACTGCGCCACGACGCAGTGCCACACGTGCACTATGAATGGGGACCGCTTCGTGGTGGAA
ACCCCGACGAAGTACTACATCTCTGAGTACGGCACGCTGAATTTCACGACGTCAgacgagttccagctccaAGCGATGAACGAAATTTACCACCGTGGCC
CGATTGTTGCGAGTATGTACTCCTGACGCCGGAGTTCAAGCAATACAAAGGAGGATATATCCTGCGAGACTGGGGACAGTATCCCGGCACGACCCATGTC
GTGAGCATCGTCGGATGGGGCTCCGACGCCAAGACCGGGATCAAATTCTGGATCGTGCGTAACTCGATCGGCACGCATTGGGGCGACGGCGGCTTCTTTC
TTGTGGAGCGGGGCACGAACACTTACAACATCGAAAACAAAAGTGCGTGGGCCATACCTATCGTGTAGAGGCTTCGGCGGACGGGTGTTGTAATGGTTGG
TAGAGCCAAACGTCCCGAGTGCTATACAAGTAGCATAcagctttcttcttctttcaGTCTTTCGGTCTTGGGGTCTTCCTGCCCCATTGCGCAACTTGAT
TCGAGTTTCCCGGCTGCAGCAAATCGATCGTTAATCCAGGTCAGGCACGAACCGTGCCTGACCGCACGATAACCATCGCTTTCTCTTGTACACAGCAACG
CACCGCGTCTTAATCCACGAATGTTGAATATTGTAGTGCATTGCAACACCGACATTCATGCTTTTAACAACAATTCAGATAGTGCACGAGGAAAATACCG
ATGCAAACGCCCCCTGCTCGGTTCTTTCAGGGCAGGACGACGTCATCGTTGGGGGGATTTAGTACTAGTTGCAACCACCGATGCACGTCGACAAAACTCG
TCCCTGGCTCACGAAGCGAAAAGGTATATATTTAGATAGTTTGTAGATAGTTTGCGTTAACACGGGAGGCAACGCAGTCCAGCGTAACGTGACTCGCGTC
TGCCGCTCCAGACCATtggacgccgtcgcagcGCTTTGGGACGCGGCAGCTTTCAACGATCTCCGTCGCTAGCCACTCGCGGGCGTGGGTCAGCTTAGTA
CTCGCAGCGAGTGCGTGTGGCATGGCAGTCCTTCTGGGGACCATTTGCCGGCAAATTGCCGCGCAAGAGCTCACACCTGCAGAAGATTGCTCACTCATAC
TATCCCAACGGCCGTTACGGCTTCAGGGTCCGCGTCATCGCTTATTAGCCAATCAGATCGTACAATGGAGACGTAGCGGCGCGAAAATGTATCCATCCCC
TCTGCCCTTCCAGAAGAGAGGAGCTCTTCGCCcaaagagagagagagagcgagaACATGGCACCGCTCGCTTGCACCTCACTACAAGATTTCCTCCAGCG
GTCTCACGTCCAGCACAATGGCGATCACCGACAAGTGCGAGCTCCCTCTACTGCAAACCCGTACCAGCACGCTCCTCAACGCTTCGCAGCagacttcaac
gtcgtcgtcgtcgctgctgcggtcaACTTGGGAGGGCATCCGCACCGaccgcttcaagctgcgctCCATCGGCTCCGTGCTCGGATGGATCGCATTGGGC
AGCTTCGTCAGCTCGGCGGTGCTCGCACCCAAGCAGCTGGTCGACTACACGCACGACGGGGTCTCGATGCACGCGGTGCAAGACCAGCTCGACTTGATGG
CGGCGTGTGCGTCCACCGGCAGTGCAAACGGCGAGGGTGACGTAGCAGACGTTCAAACCAACAAGGGCGCCGGCTGGTtccttggcggcgacgatcCCGA
GCACGtcaagacgtcgctgccggaaGTCACGTCGTTTGACGAGCTCCCTGAAAACTGGGACTGGCGCGACTACAACGGAACGGGCATCAGCTTGACCACC
AGCGTCATGAACCAAATGGTCCCACGCGCATGCGGGTCCTGCTGGGCGTTCGCCACCGTGAGCTCCTTGTCAGACCGAATCCGCATTGCGCGGTTCAAGA
AGACTGGTCGCCTGGACACGGAGATGCTGCTATCTCCGCAAGTTTTACTCGACTGTGGAATGCGCTCGTTCGGTTCGTGCCACGGCGGAGACCCGCGATA
CGCGCACAAGTGGATCCATGAAAACGGCATCGTCGACTTGACGTGCAACCCGTACATCGCGTCGCATCCGTCGTGGATGGGAGGAGGGGAGTGCGCTGCG
ACGCAATGCCACACGTGCAACCTCAAGGGCGAGTGCTTTGTGCTGGAGGACCCGGTAAAGTATCGGATCTCAGAGTACGGCACGCTCAACTTCACGACGC
CCGAGGagttccagctgcaggcgatGAACGAGATCTACCACCGCGGCCCCATCGTCGTGAGCATGTACTCACTCTCACCAGAGTACCGCCAATTCAAGGG
AGGCTACATCCTCCGCGACTCAACCAAGTACCCCGGTACAACCCACGTGGTGAGTCTCGTAGGCTGGGGCACCGACGCCAAGACGGGCGTCAAGTACTGG
ATCGTCCGCAACTCGGACGGCACCAACTGGGGCGACcacggcttcttcctcgctgAGAGAGGTGTCAACATTTACAACATGGAGAGCCACGGCGCCTGGG
CCGTCCCCATCGTGTAGAAACCCATCTTGACCAGTAAACCCTAGAGTAGTAGTAGAGGCCCTTGACTCCAGAGTCTGGAGCATGTTGAAGCCATCTGACC
AATCGTAACAGGAGGACTATTTCATCCGTTTGATACCATCCTTTTCGGACTATTTCCCTCTCCGCCCCAGATTTTGGTCATCAATCTATCGGCGATGTcg
caactgctgctccggTCGTGGCGCTCCTCGCGCGCCGGCACCACGTTCCGCGCTCTGAGCGTGTTGAGTGGCATCTCGGAAGATCTCCTtgtcagcacca
gcatcggCCACCAGATTGGGGGCGACTCGCACGCTGCGTTGGTGGACAGTTTGGTCCGGACGAATGTGGTGGATGCCGGCTCGCgactggaggcggcgct
gagGCGTGTGGACCGCGGGGACTTCGTGGCGCCGGCGTTCCGGGACACGAGCAAGCGATACGCCAACCGCCCCTTGAAGATCGGCACGGTGGCTACGATC
TCCactccgcagcagcacgcgcaggtgctgggGCTACTGGAGCCACACCTGCAGCCGGGAATGACGGCGGTGGACGTAGGCTGCGGCTCGGGCATCCTCG
TAGCTGCGATGGCTCACTTGGTAGGGCCGACGGGCTATGTCACGGGTGTTGACATTGTGCCGGAGTTGGTAGAGTTCTCGAAAGAAAATTTGCAGCGCAG
TTTGGGCAAGGGGGCATCGGACAAGCAGACGGAGATCATCGTCAGTGCTGGGAAGAAGGACCTTGGTCTGCCGTCTGACGGTCTGTATGATTGCATTCAT
GTTGGCGTCGCGGTGGAAACCAAGGCGGAAGCGGAAAGCTTCTTGGAGTATCTCAAGCCTGGTGGTGGGCTGTTGATCCCGCTTGGCGGTGCGGGAGctg
agcagaagctggtcaAGGTAAGTCGTGTATGCGTAGCACAGACGACGAACCTCTTGCAGTGAGTTGAcgtttttttcttttcttcgATGCGTAGATGACG
AAGCTTGCCGACGGAACGGTGGACAAGCGCGACGTCATGAGCGTTCTTTGCCAGCCAATGCTAGACAGCATCCCGATCGAAGTAGTCCGGGAGACTCGCG
CTGAGAAGCTGGCCCGGGTGGAGAAGGCTCTCACGCAGTGGCGTGAGGATTTTGAGGCCAAGAACGGACGGAAGCCCACGCGAGACGACCTCATGAGCAA
TGCTGAGTCGAAAAAACTCTTTCAAGAGTTTGCTGCACTGAGAAAGTAGACGAAAAATAAGTGAGCTCAAGTTGTCAGTTTCAGTTATGAGCTGGAGTAC
GATTCTCATTTTCTTCACATGAGGATGGGGTTGGTGTTGTCGTATCACGCATGCGCCGCTGCCTTGGTTttctgcaggagctgctccgCGAGTTGGATCT
GGTGGGTAATATGCTCACGCTGCGTCATTTTCGCGTAGCGGGGCGGGTTCTCCGGTGTCACAAACAGTGGAAGTGGTTCTACAACGGTGTTGCCATTAGC
GCCGTTAAAGCGCACGATCGACTGACGCTTTTTTTTTGAGTTGCACACGCGGTGCTGCAACACACAAGCACGACAAGCAACCAAGCTAGAAAAAGAAAGT
TACCCTTAAAAATACTGCAAAGCCGAGTACATTACCTCAGTCGCGACTAGCACGCCATTAGTCCAGTGCTCGAGCATGTCGCCAACCATGACAAAGAGCC
TGTGGTAGGAAAAGTAAAGCTGGTCATGGTGTACGAGTGATCTCCAAATATACGACAACCTGCCGTACCTGTCATCACACACCGGAGCTTCAACCCAGAC
ACCCTGGCGGTTCATCAAGTGCAAACCTTCGCCGTTCTGATGGATGACAGTGAAGCATTCGAAATCCGTGTGCGAGGCAATCCCAACCGTAGAATTCTTC
ACGAGGGCATCCGTCTCAGGGTACGTTAGCAGTCGCATGAATGCCTCCGCTTCTtcgtccacgtgctgctACAAATCCCCAAACAGCAACCAAGTCAGTA
CAACGTTTGCCAAATTCGAAAATATGGCACTGCGTACCAGGAACGTGTCGGCCGGAAGTCCGAGCATTTCCGCAAAGCTCTGGAACAGTATCATTGAAAG
CTTGGTGGTCTCCTCGTACAGTGCGTACACGTCCTCGCGAAAGTGCGGCACTTCGGCTGGCCAGACATTCGGACCCAAACTCGAGCCCTCCTTCACGAAC
GTCTCCGGGAGCTCCCGCGCGAGGTCGAAGCCCTCCAAGTGCGAAACCACATCCGGTTGGTACTGTACCATCCACCACAACACTACAATGAATAAAACTC
AAACCACACCAGCATATTCTCCACGAATCCCAACGTACCGACGGCTCCTCGAACATGGGCGTCCAGCCTCGAGCATTGGGCGAGCGCTTGCAATGGTACT
TTTGCTTGACCGCGTCAGGCAGCGCGATGAACTCGTCTGCTCGACGGTACGCtgcctggagcagctggcTAGACAGCACTCCCTCAGCGGGGACAGTGAA
GAATCCCGTCTCGATGCAGGCAGCGCGCATggcgtccaggatctgggTCCTGGTCTCGGGCGCCACCTCACGACCGCTGTTCGCAGCCGCCACCAACGGG
GAGACatccacgagcggcagctgctgcagcgccaccttggaCGCCGTCATCACGcgcggcgacgagaagctccgagcgcccagcgccgcgcgagACGAAG
AACGGAGGCGTGCGGTCCACATGGGGAGTGCCAAAGTGAGCCGCATAGCTTCAACATGGTGTGATGTACACCGAACCCTTCATTAGATCATATATAGCCT
ACCTAATTTCATACAGTCCGAAGCCTACAGCTCACTGCTCTCGATCCGACATGTCGTAcctggcgacggcgacgcaTTTCAACAACTGGGTCTTCtcggc
ggaggagctggcgcgtgtgcggcggctgcagcatgtGAAGGCCAAGCGTGCGTTGCGTCTGGAGCGAGAGGAGGCCCAGAAGCCCGAAGcgacggccgcc
agcagccgcaaAGCGCGGTCTTTCGCCGCCTTGGTGCCGCGCTCGTCGACTGCCGTGCGCGACGCCTTCGACTGgaacgacgaggtggacgtggagcttT
CACCGCTagaggaggtggaggagaaggcaAATCTGCAActgacgccgctgctggagttcctGAGcccggagcaggaggcgctgcttCGAGCTTTCTACGA
GGAGAAGATCCAggagagctgcagcgctcaGTTCCTGCGCACGTCGGACAAGGTCAAGTGCTGCGCCATGCTGCTATTCAAGAGGTTCTATCTGAGCAAC
AGCGTGATGGAGTTCCACCCCAAGTACCTCGTCCCGACGGCCATCTACGTGGCTGGcaaggtcgaggagcagTACATGTCCGTGGACACCGTCGCCGACC
AGCTCCATGTGGACCACAAGTTCATCATTGGCCACGAAATGATCTTGCTGGAGGGCGTGCGCTTCCAGTTAATCATGTACCACCCGTTCCGTACGCTGCT
GGGCTTTCTGGACGACTTCCGTGCGTTCGCTAAGCAGGTGCTGAGCAAGGACCTACCGGCGACGGTGCTGCAAAAGTTGCACGCCAACTCGACTGCTCTA
CTCAACGATATGCTGCTCACAGACCTGCCCATGTTGCACTACCCCTCGTATCTAGCGCTTGCAGCGCTGTGGCATGTGGCGGACGAGGTTGCTGCCAGCA
GCGGTGAAAAGGCTTGTGGGCTCGCGAGCGCCGATGTCCTGGACTACATCAAACGCAGTAAGTTCTCCAAGGATCAACCCGTGGATGAGGTATCTGGTCG
GCTGGAGCAGATTACACAGGCGTTCCAAGCGCTCAAAACAgacaaggagaagggcggcgaggaggcggcgcacCATCGCGCCAAACAGGTCAAGCGTATC
TACAAGAAGCTTAAGCAGTTCCACAAGGATGACGAGAACAGGaaagacaagaagaaggacaagaagcgcaaggccaaggacgaTAAGAAGAAGGTTaaga
agcagaagaaagACAATGCCTAAACGCGTAGAGTCTCCCGCTAATGAACCGCCCTAAGTGTTAAAGTTCACCTTCCAATGTCCCCGAACGCCTGATAAAG
ACGGCAGACCGGAAGATTGCGGCGTTATGATATTATCATAGTATATAGGATTGCACTTGGCAAAAGTGGCTATTCATCTacctcctcggcctcctcctct
tcatcctcgtcgtcgtcgtcgtcgtcgtcgctaccTTCCTCCTGCTGTTCCGCTGCTAGCTTCTCACCTGCAATCGCAAACAATAAGTCAGATCTCCACC
GCTCTGTCAAAAGACTCCTCATCTTCCCAGACGTACGCAGGatctcgacgatggcgtGCTGCGTGCGCCTCTCCAGCTTGCGTAGCATGGGTGCGAGGTC
GCGCTCGATGTCCCAGTTGGCGCGCTTGGGCGCGAGGTTCAGtagttcgtcgtcgctctcgtcctcggtCTTGgcatcctcctcctgcgcctgcgccacc
ttctccgcGAGGTCCTCGGAATTGTCGTCGGTCTTGGCCGAGGCGTCGGCCCTgtcggcctcttcctcctgcaTCGGCTCATCCGCAGCATACTTCAAGG
CCTTTGCAACTAGAGTTCCGGCCTCTCCACTGTCGCTCTCGCCGTGCTCCTTGCGGGCTTtggcctcgcgcagcagcttcagccgctTGGCGCGGGGCAT
CGCATCGTCGGCATCGGTGCCTGCCATCTACTGTTGCGTTGTGTTCAAGCTGTGTGAATGGTGTGTGACCCACACGAAAATATGAAATTATTAATTGTCT
AAACAAGTATGTTTAGAAATACCGTCGACACCAGTAATTCTGGCCTTCTGTCTATTGGCTAGATAATCGGCTAAATCAGTTTAAAGCAGGCGTCGCAGGT
AACCCCCCTCAAGAATGGGTGTAGACCATCGAGTCTTGTGCGCTAACTACTGCGTCTTTTGCTGATctgtttgctgcagcagcttgccaaTACACAGTAC
CAGCGCAGCGATTAGCGGTGgggcgcagcagacgcttcGTGAAGGCATGTGAGTGCGCGTATAGAGAGCGTTATGCTGCCACTTTGTTTCGTGCGACTAT
CTGTTTCTATATTTAGAAGGGGCTGGGTCGAGAGATAAACTCTTGCCGAGCTTGTCGCTTGCGAGGCAGATTCTCACGAGCTCGTTTGATCAATATTTTG
CGAGTCAACCCTGTTGAATTAACCAGCTTGGCTCTCTCTCTGCTGAGTTCCAGTAAGGTCCACGGATTGCACCAGATCTCATAACATACGGTGGAATCAC
CACCCCGCTGCTCGTAAGCCAAATAATGAATCACTTTAGCTTTCTCTCCAACAAACCCGAGGTCGAAACGCAGTGCACGACATATTGTCGCGTCCGACAA
GCAGAGTCCGCTGGGAAAGTTAGCCAAAATGGCttcacgaagctcttcaaaCTAAAAACACGCATGGCTTTCTACATATTCCAATACAAACGCACACACA
GGATCGGGCCACTTCGATCTCTTCTCAGTAGCCGCCTTCTTATCTACGATACCTGTGAGTAGGAACCATCGGTACCATATCGTAAGGCTTCGCTCGGAGA
TACCAAGTAGCCTAGCCACCAGGCTCGGCTGTATGTCGTAAGCATAAGTGAGGACAATACCACACCATCTCAGATTA