Description :
From Genome Similarity Track
Location :
Scaffold_66:7777- 9253
Sequence
1476 bases(100 bases per row)
TGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGCGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGAGACGGAGTATGCGGACGT
GGTGAACAAACACCCACCGACCCAGGTCCCACCTGATCGAGGCGTACGGCACGAGATTAATCTCGCGCCCGGCACAAAGTATTGTGTCACGAGGCAATGG
CCCCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTCGACGCCGA
CTTTCTGCGTTCGTAAACCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCTGGCCCAAACACCAATCCCACGAAA
GGATGTGTTGCTGAACAACATGGCCTGTACAGTGCGCTAGATTTTGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGG
TAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGACGCAGGGCTTGTCTAACGCCCCGGCGACATTCAATCGCCTAGTGACGCATTTGTTCCG
CCCTTTGCGTACCTTCGTACAGACGTACTTCCACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTT
CGTCGAGTGTTGGACGTAATGCGAGCGAACAAACTATACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGCAA
GCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGACCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGC
CAACTACCTTCATAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGG
ATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCTCTGTCCTGGCCCTGCCGGACGAGACGAAGTCGTTTAGCGTCGTCTGCGATGCCTCCGATTA
CGCTATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCC
GTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCTGTAACGGGCCTAGAGTGTCCGTTACTAGCTTACACGTAATAATGAGGAAGC
GTGCAAGCTCCGCGATAGTGAAACCAAGTACTTAGTCTGAAGGAAATCAACTCTGGTTTTTATTTAGGTCCAGGGCAGCTTGCCCTGACCACTCAAATAC
ACGTCAATCCTTATTAGTTGATTATGGGTCTGGCTCCCCATATTTCAACCAATAAGGTGACGGCAGTTCAGCACAC