Description :
From Genome Similarity Track
Location :
Scaffold_365:7776- 10786
Transcript NameFunction/comments
Phyag_g5086serine protease family S28, putative
Phyag_g5087hypothetical protein PHYSODRAFT_329926

Sequence
3010 bases(100 bases per row)
TTACCCCCACACGCAAGGGCCGGGCGCCTGTGGCAGCTCGTGCAGGCtgaggagcagctgctgttccagaCAAATGCACAGCGCTTCTGGTTCAGCCAGC
AGATCGACCACTTCGCCTCGgatggcagcaacgccaccttccagcagcgatACTATCAAGTGGACAAGTTCTGGACAAAACCCGATGGGCCCGTGATCCT
CTACATCGGGGGAGAAGGCGCGATGGAAAAAGCCCCGACCGGCTTCGTGGACGTCATCGCCCAGAAATTCGGTGCCAAGGTGAAGCTCACGAAGACAACG
AAGCCCTATAAGGGGAAAGGAAGATTGCTCATTTATCATACTTTTGTGCTGCTTTTCATCAGATTCTGGCACTGGAGCATCGGTTCTACGGCAAGAGTGT
GCCGAACGGGGACCTTTCGACCGCCAACTACCGCTACCTGACGGTGCAGCAAGCGCTGGCGGACCTAAAGCACTTCAAGGAGAGTCACCAGAGCCACCTC
GGGGCTGACAATGCCAATCAGTGGATTGCAATTGGGGGATCTTACCCTGGAGCTCTCTCGGCTTGGTTCCGTGTCGCCTACCCAGACACGACAGtcgcgt
cgctgtcgtcgtcaggGGTGGTGCAGCCAGTGTACAAGTTCCACCAGTTTGACGagcaggtggcgctggcAGCGGGGCCGTCGTGTGCTGATGTGCTGCG
ACTCACCACCGAAGCGTTtgagaaggagatcgcgaGTGGCAATTCGACGAAGGTCAAGGGCCTATTTGGCGCGCAAGAACTGGCGGATGCCGACTTCTTC
TACATGATCGCAGATGCCGCAGCGATGGCTGTGCAGTACGGCCACAAGGATATCGTGTGTGAAAGCATGGTTGGAGCATTTGAGCGCAATAACTCGCTGG
TAGACTCGTTCGCCAGCTTTACGATCGATATGTACGGGTCTTCGTTTGGTAGCGAGTGCTTCTACGACACAAAGTGCTTGGCACAAGACCACGCTCGCTG
GGGAGACGgacgctcgtggcgctggcaGAAGTGCACTCAGCTTGCATACTTCCAGATTGCCCCCGAAGAAAAAAGTCTGCGCGCGGCAATGATTGACCTC
GATTACCACTTGAAGCAGTGCCAAACTGTATTCGGCGACGCAGTGAATCCAGCCAAAGGTGTGGAGGAGATCACGAAGCTGTACGGCGGAGATCACCCTC
CTGGCCACAagatcttcttctcgaacggAGTCGATGACCCGTGGCAGCGTGCGTCGGTACTTGAAACGCTGTCAGACGACGAGATTGCCAATTTAGCGAA
GTGTGAGCTCTGTGGTCACTGTGGTGATCTGGGTGCAAATCCGAACGTGCCTGAGCCACTGAAGAAACAACGCGAGCAAATTCTCGAGTATCTAACAAAG
TGGCTCGGCGTCTCTGGTGGAATGGAGGCCACGGAGAACGTCGTGCATGAAGCATCCGCTCTTCCTCTCACgcaagaggacgaggagcaaGAGATGGCAG
GACTGCAACTGGCCGGGTTGCACCGATCGTCGCCACTGGTCCTTATCCCCATTGTTGTCGCGTTCCTTGCATTAGTCGCAGTACTGCATGCTGACGTTGT
TCGCGACGCTCCGGGGCGGATGGAGATGATACGATACCGACTGGCACACACCCACGAGTTTTAGCATTGCAGCAGATAAAGACGACACCACCTTTGGCGA
GACGAGATGGGGTAGAGTAGCAGACATACGATGACTCTGGTCGCTTGTGTATCTTCACctttttttcatttttctTGAAATGAACGTGCACGTCCATTCT
AAGTTTGAGTCTATAGCACACGCATCAATATGAGTCTCTCTCACTGATGTAGTAATCGGCAGTGTTCGAGACAGTATTAAGCTGTCTGTGTCTGCAATTT
GCTTTTAGCTGGTGCGGGAAGAGTCTGGCCCATCGTCTCTTTTGTGGAGATGTAAGCGTACGCTGCGCCGCCAATAGATACAACGATGATGCCGACGGCC
TTCTGCACTGTGATCACGTCGTGGTTGATAACAATGGACATTACGATGACGACCACTTGCTTCATGTTGCCGCATACGCACAGCGTCACTGGAGAAGTTA
CCTGTAGTACGCAGCAATGAAGATAAAATGTTAGCCACCAACGAACAATTTGAACCGAGCACCAACCGCAACGGTGAGGAGACTTACCTTGTTTGCCATG
AAGCTCGTGACATTGAGCATGAAGCTGATAACGCCGGTCAGGATGAACCAGAAGCTAGCTGTCGGTACGACTTCCCAATTCTTCATGATCGTATCCACTT
CGCCCGTCAAGAACATGGTGATCAGACACCAGCAAGCGGACAGCGGTGCCTGATGCAGGATTAGGTCCACAGGGTGCAACTTCAGGTCGCCACTAAGGAA
CTGTATGAATAAAAGAGCAACACACAACATGAGTTAGTTTATCACCTCAATGCCACAACGCTCGTCGTTTCTTGCCATACCTTGTTGGAGAGCACCGCCT
TCAAGCCTGCGAAAATAATGGCCACAACCGTGATGGCGAAGCCCAGCACCGTGCACGAGTTGTCTCCCGTGCACGCCAAGTAAACGCCAAAGGCCACGGG
GACGAGCGACAATTTTCGTTTGAGCGAGTACGATTTGCCGAGGATGAGAAtgctgagcacgacgacgacggtcgGCACGAGCGCGCGCATGACCTGGTTG
AACGAGATGGACACGAGTCCGAGACTCCAGTTGCCTGTGATGATATTGCTCACGAAGATGAGCGAGAAGTAGAccatgagctgcttctggcCGGGCTTGA
GTGGCTTGCGCTCGATGCCCTTGTACACGTGGATGTACAGGAATGCGCCCAGTGTGTTGCACGCCATGTGCACGAATGTGAGCGTCACAGGCAGCCGCAG
CGCacccagcgccttcttgttccAGAAGGTCACTCCGATGTTCTGTGTGAACCACATGCTGAGCCAGAAGACCACGACGGACGGCGCCACGTACGACGTC
TTGGctgtgg