Description :
From Genome Similarity Track
Location :
Scaffold_6:777568- 785555
Sequence
7987 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCC
TGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCC
GGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAGCCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCG
TTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAAT
GAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAACACCCTTGAAGAGGCGATTC
AAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAA
CGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAA
AGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGG
GCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCG
AAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCAC
GCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTGTCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATG
ATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGG
TGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGA
CGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCT
GCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACG
CTTCCTGTGTGGGTAACACAGTGCCACACACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACA
CGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTGGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTA
GCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGAAGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGA
TCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTATCACATCTTCGATAGCGAGACGGGTTTACC
CGTCAAGGCATCTGGTGTCCACTTGGAACAGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGACGGCTGAGTCTTTCCTGGCCAACCTCAAG
GCTGGAGAGATCGCTGAGATGGTACTCATAAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGA
ACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTATGCGGACGTGGTGAATAAACA
CCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGC
GAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGCTC
GTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCGATCCCACGAAAGGATGTGTTGTT
GAACAACATGGCCGGGAGCGTACTGTACAGTGCGCCGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAGAGTGACATCCCGCTCACCGCGGTA
AGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCC
CTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCG
TCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGC
AACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGTTTGGCCA
ACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCTTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCA
GGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGAT
TACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACC
CTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGC
GTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCG
GGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCA
TGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACG
GCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGGTTGTACCCAACGACGAGGATCTGAAGTTC
GACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGT
ACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCGGCAGGGCACTCTTCGGCTCCACTACAGAGCCTGCCCGTACCGGC
TGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAG
ATGGTACATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACTGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGAGACGA
TTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGATCATCCGCA
GACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACGTGGTCGACGCAGCTTCCAGTT
GTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAG
GAAACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGA
ATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATAGACAAAAGGAGTACTCAGACAAACATGGAAGA
GGAAACTTAAGTGTATTTAAAGTGGGGGACTTAGTGCTATTAGACACGAGGAACCTACCGCTAGACACTGTCAGCTCTGTCGGCAGCAACAAGCTGAAGC
ACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACCTTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGG
ACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCCAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGG
GCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACGCCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGC
CGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATC
ATGCAAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGGCTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAA
GACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCG
GTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCC
GCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGG
GGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTC
ATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATG
TCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCC
ATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAGAACTCCATGTGGGACAGTTCTCGGGCATAACCCAGGGGTA
TCCCCAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGA
GCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGA
CGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGA
ACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCT
TCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTAC
GCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCC
ACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACG
CTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCATCATGAGTGCTCTCGAACTCGGCATCGTCCTCACTGCCCG
AGTTGAACTCATGTTCTACGAACCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTC
ACCCGAGGATCCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTAAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCCTGCGCCTTACCGGCT
GCAGCCTTGAAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTCGAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTC
GAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGGCCGAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTC
TGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCACTAAGTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAG
GAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAAACCAACCATTGGTTAAATGACATTGCATTACTATAGGTAACTGA
TAGTTTGTATTAACCTCAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACC
TGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAAGTAA