Description :
From Genome Similarity Track
Location :
Scaffold_664:7774- 16385
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_664-abinit-gene-0.28General transcription factor IIH subunit
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.8Calmodulin-binding transcription activator
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.9Calmodulin-binding transcription activator
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.18Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_664-snap-gene-0.11Gene of unknown function

Sequence
8611 bases(100 bases per row)
TGGTGCTCGACGTGCCGGCGTGAACGGTGCCCGCGGACGTGCCGTCCGAAGACGAGACGGTCGCCGAGCTGCCCGAGGCCGAGTCCGAGTAGTCGGACAG
GCGCGTGAACGTGAGGCTCTCGAACTCGGACTTGAGCGTGCCGGACTCGTCGAAGATGCCAAAGTGCGCCTCGACCGTGTTGTCGTCGTCCTCCTGCTCC
TTCTTGTACGGCGTGTCGAAGCCGGCGAAGTAGTAGTACTTCCAGCCCTTGTCCTTCGCGAGCCAGAAGAAGTCGTTCAGGTAGCGCGCGGCGTTATCCG
TGGACGCGACCGAGCCGTTCTCGGCCGTGCCGGCGTCCGGCCAACCAGTCTCACTGATGACAACGTCCATGTTACCAGCGAGCTTGAGCAGCGGCTGGAT
GCGCGAGTTGAACTGCTTGACCGCCACGTCGGCCTCAATAGCCTCCCAGAACGGGAACTGGTTGATCGTGACGATGTCACCGGCCGTGATCATGTCCGGG
TACGAGATGAACGTGTCGATGATGTCTGTGATGGAGACGGGGACGCTCACGTCGTTCTCCTTCATGATGGACCGGAAGTCGGTCACGTACTGGATCGCCT
TCTCCGCCGTGATGTCGCCGCGGTACACGGCCTCGCTCCCGACGTTGATGCCCACGACGTTGTCGTCGATCAGACCGGCCGAGATGAGCTCCTTGAAGGC
CGCCACCTCGGCTTCGTACACCGTCTCGTCCTCCGACACCCAGACACCCAGCCAGACGGTGAGCGACAGCTTCTTGGCCGCCGTCAGCACGTACGACGCG
TCGCAGTCCGAAAGACTGTACGTGCGCACGTTGGACGTGACGGTCGCGAGGATCTTGAGGTCGGCCGCGATCGTGTCGGCGTCCTTGCACTTGGCCGAGT
CCCAGTCCGGGCCTTGACGCATGTCATAGTTGAGACCGTACAGGTTCTGGTCCAGGCCGAGCGCCGAACCAGCGAGCAGCGCCGCCGACAGGGCGAGCGA
GCGGAACACCATCGTCAACAGATCGTGTGTACCAACCGGGGCGGAAATCGGTAAATGCGGGGCAACAGACAAGGATCGGGAGGGAGCCGTTTCCCTGGTC
TTATCGCGTTAGAGGGGTTTTTGAACCGGACATAGAGTGGGAGAGAGAGCCAGCTGTCGGCCTGTCCGACAATTTCAGCCAATCCTTACTCGAGCAGTAA
CAAATCGCCTTCAAGGATTGGACGAGCCACAGAAAATAGCGTCGTCGTGTTGTGGTGGGTCAGCCGATCAGCATTAAAATTGTTTTTGCTGTTTTGCTCG
CAGCCATACCGAGCGACATTAGTTTTGCTGTTTGCGGAATTGCGAGAATGGAAATTTGCGATTCCCTCCTGAGATGTTGCGACACAAGGCTGCTCAGAAC
GTTCCTGGTGCGTGTTGAGTGAGCTCAGCAAGCGTTCCCTCGCAAATGTGAACACCAACCAAGTTCCAACACACCAGCACCAGCAGTTCAACCACCACCA
GACTCTCGTTTTAGCGGCACGCAGATTGTTGTCAGTCGCATGGCTCTATGACGGCCGTTAATTACTGGACGGGACTGGATTTTCCATTGCAGAGAGAGAG
AGAGAGAGCTGTCAAGCGAGAGCAGATTCACAATGGCACGCTTTTCATTCGCAGGTTCGATTGCGATGCGATGAAGTCTTGTGGTACAGGAACCAAGCAA
TTATTGGATCTCGTTTCTGAGATATCAACACTAAATCAATATCTGATATGTCGATTCCTAAACCTCCGTTATTGTGCTTTAGCCAACTCCTATTCAATAT
AGTGGACGAACGATCGATCTCACAACCCATTCTTGAAGGGCGGCCAACAAGCTTACGCGCAGCGAGCGGCCGCCGCCCGAGCATGCCTGATGCGATCCAA
GCGCGCGCCGCCGCCCTGAGACTCGAGGCGACGCGGAGATGGCTAGTCAAAGACGAGCTGATTTTCCTGCTGCTGCACTACAAGCTCTCGGGGGTTCCGA
TTCTGCGGACGCTGCGTGCGCGGCCACCGAGTACGCGATATCGTCGGCACGCGCTGCACATTGAGACGCAACGGGACGACTAACAAGGATGAGTTGTGTC
GTTATTGGTCGACGCAGGCGGGAGCTTGATGGTGTACGACACGCAGGCGGTTCCAGAGTACAAGAAGGACGGCTGGCGGTGGCAGAAGCGCAAAGACAAA
AGCGGACGGGTGAGCACTTGTGATCCCGAGGCAGCCTCGTGCGGATGCTGATGGAATGGCGATTTTTTTTCTTTGCTTCGGAAAGGTGCGAGAAGATCGA
GCGAAACTGGTGATCAACCGGGCAGTGATCATCCTCGGGTCGTACGTCCACTCGGCTGATACAGCGGTACACTTGTCGATTGTACTGTAACTCGAGAGCG
CAGACAATGCCGAGCTGACTCGGTGCTTGCTTTGCACAGACTTTCCATCGGCGGAGCTACTATCTGCGCGACTCGAACCAGAACATCGTGCTAGTGCACT
ACTTTGACGAGGTCCACAAGCAGCAGCTTGGAGGACACCCATCATGCGCATTAGCTCCACCACTACCACACTTCCCTGAAGAGATCGACGTTTCAAAAGT
CTCTTCACTGCCGGGTGTCGATGCTGCGGTGCAATCACAAGAAGAATCTGTCGATGCTGTCATGAAAAGTACGCCACTGTTTTGCTCTCCTTTCCGGCGT
TATGACATACTGACGCATGCTCTTGTGTACGCTGATGCCAAACTGTCAGAGTGTTTCGCCTTGGACTATTCGCACACCGCCACCGGCCTGACGCAGCAGG
TTCCGACGAGCTCGTCCGGCGATCAAGATATTGACATGATAATGAAGGACGGGATCACGCCCGACTTTGTGGACGACGTGCTGTACAACGACGCTCCAGT
CTCGTCGACTGAGCTGGTTTTAGCCGACAAACGCGCGAACATTTCGGACTTTTCGCCAGATTGGGACTTTGCCGAGGGTGGCGCAAAGGTGCTAATTTGC
CTGACGTCCTCGTTGCCGGTACCGAATGGCTGCAACGCATCGTGGCCGCTGTTTGTTCAGTTTGGACGGAGTCGAACGCCTGCAGAGCAACTGTCCGAGA
CGGTGCTTCGATGTACAGGTGCGCAGCTGCTTTATTGTCGTTATCCTTGTCGAATGCTAAGCGGAAGCTTTTGGCAGCCCCAAAATCGACGGCGGCAGGC
GTTGTCGACATTTTCGTTTGTCGCTGCGAAGACCTTCAGGCGAACGATCTCATTATGCTGACCGAGGCAAAGCGTTTCGTGTACCGAAGTCACGAAGAGT
CGTCGCCGGTACAAGCACCAGCGTCGGAACCGCGCTCGACAGATTACAAGGACCAGCCATTGTTACCTTTATCAGCAACTGTCGGTGGTGCAAAACGCGG
TCGCTCTCCCAATGGCTTCGCGCTGCTCGCGCAGAGGAATCGGACGGCTGACAAGACTGCTTATGGTGGCTTCATGGCAAATCTATCGTCCTACGTGGAG
GCAGGCTGTACGTATCAACGATGGCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTCGTGTTGACAGTCACTGACGGGGTGGGTATTGTTGTCAGTGGATGA
ACGGCAGTGCAAGATCCGCGTCGTCGAGCGTCTGTCCGAGTTCCACCAAGCCATTTGGACAAATTCATCTGCAACCGACAGTCACCGAGATGACTCCATT
GACTCGATGCCGCGTCCAATCGATCAGGCGGCAACTGCGAGCATTGTTGACTCAACGAGCTCTTTGAATGAAGCCGATAGCGAGCCACCGACGTGTACGA
CCAACGAAGAATCAGCCGCGCTCGACGATAACACAATTGAAAAACTGAGCGACCACGACCTCGAAGTACTGTCCGAGAAGCTGCTGGAGCAAGTGGTACG
GCAGTTAATCGCGCTCGCTCACTCGAGCGACGAGCTTCTCGAGGAACTCAACTCGCTCGACGAGACCGGGCTGAGCTTGCTGCACTACGTCAGCTTCTAC
AACTACACGCAGCTGGTACCAGTGCTGTTAGCGCACGGAGCGCATGTCAACCAGCAGAGCACGCAGGGACAGACTGCGCTTCATCTTGCAGCGGGCTGCG
GCCACGACAACCTCGTTGCTGTGCTTCTCCAGTCGGGTGCTGATTCGCAAGTGTTGGACTTTGACGGTCTCACCGCGGCAGATCGCGCAGAGAAGTCGGG
CCATGCTGAGGTAGCGAACACTTTGCGCTGCCACATGTCCGAAACTGGAAACACCGGGTCGGTTGGAACGGCATCTCCGGACCCGCTTTTTGAGCTGAGC
GAGAGCTATTCCATGGACATTGACGACGATCCGACGCTGTACCAAGACTGCGGGCAGATGATCCCGATGCCCCTTGACATTCAATCGCCATGGCCGTCGT
CGACCGCCAGACCGCACGCCGAGAGTGCAGACCACGTAACCAAGTCGACTGTTCATTGCGTAAGTTGGTTCGATTCCATTCGACATGAGACTTGAGTGCG
TAATGCTCATCTCGAGGTTATTGTGTCTTGTGCAGCAGGCCGACGAGAACCATGAGCACAACCGCAAGTTCCTGCTCGGCGCGTTCTCGACGTTGAGTCT
GCACGACAAGTGTGCGCTGTCGCTCAGCATTTCGCGCGATGGCGGAGGCAGCTCGAGACGTCGAGGAAGCAGCGTCAGCGACGAAACGGCGTCGGTCGCG
AACGGTACTGCCTCCTCGATAAACTCGTCGCCTGCACCGAGCGCGGATCCTGGTTGCTTCTCGACTGGAGAACTGTCCGACTCGATCTATGACTCGGACG
TCAAGAGCGTGATCGCCGAGGACGAGGCGAGTCTCAACAAACTGGAGGCGGCGATTGAGCTCATGGGGCCAGAGGAGCGGCAGTCTCTCGAGGAAGAGGT
GACGGTGCTCCAGCACAACATTCGCGCGTGGCTGCTGCGCCGGAACTGCAAGAGCATGCGCGAGGCAACCAAGCGGCTGCACGAGGCGACCAAGAGCATC
GAAGGTCAGCAGCTGCAGGACCACGCGGACTCAATCACGGCGTCAACGCCAGATAGCGAGCGTGCGTGGGACCGCGAGCGCGCTGCAGTGACGCTGCAGG
CGGCGACGCGCAGCATCCTCGCGCGCAAGAACTTCCTGCAGACCAAGCACGTGGCCATAAAGGTGCAGGCGGCGACGCGCGGTGTGCTGTGTCGCAAGCA
CTTTGCGCGCATGAAGGCGCAGGCGCAGGCGTCGCTCGTTATCCAGCGCAACGTGCGCGAGTGGTGGCACAAGCAGCCCTCGGGTGGCGGCGAGCCGTCC
GAGGCGGTGCCTCCAAGCGACAAGCTCGAGCAGAGCGACGTCGACATGACCAGTGAATTAGTGTAGCATACTCATCGAGGAAAGGACCCAGCTCCATACA
CCAACAGGACCAGCTGGCTTCTCGAGTCTATTACCGTTGCCGAGAGAGAGAGAGAGAGAGAGAGAGCTAACACCCGAGTCGGCGCTTACTCCTCGGCCTC
TTCGTCCGTGTACCGCCGGAAGTTCTCGATCGGTGGCGTCCACGTCGCCAAGGTGCGCGCGTCTGGCACGGGCGCGTCGTCCTCCTCGAGCGCCTCCTGC
TGCAGGTGCGGCGGCAGCGCGTTGATAGCGTCCCACTTGAGGTCGATCTTGGTCTGCAGGTCGCGCATGAAGTGGTTGTGCGCGATCGTCGTCTGCACAT
TGTAGCGGTGACCGACCTCCTGGAAGCGCGCCTGTTGCTCCTCCGTCCACTCCTCGCTGTGCACATCCACACACACACACACACAATGTCAGCCACTACG
CCGCCTCATAGCTGCTAAGATTAAACCCATAGGCGAGACGCACGCGTCCGGGTACTGGCCCTTGATGGCGCGCAGCATCTGCTCAAAGTTGGCGTCCTCG
CCGCCCTTCTTGCCCTTCTTCTTGGCCGCCTTCTTGGAAGCGAACGGCCGCACGCCAGCGGCCTCGAACAGAGCCGACGCGCCGGCGCCGCGGGTGACTC
CGGCGGCGCGCAGCCCGCGCGGCACGAGCGACAAGCTCAGGCTCATTGTCTCCTGCGAGTGATCGTCGGCGCCTTCCTGGCCGCTCGCGTCGCTATTGCG
ATCCCGAGCCAATCAAAAGGAGCCGATGGAGTACAATTGTAGGCGCATTATGTACGATGTTTTTAATTATGGTTGATATACGTAAATACGACTAGCGCTG
AGGGCACATCGAAAGCAGTTCATACATGTTACATTGCCATTTTACACGAAGGATACAGGGCTCGGAGATTACGCTTTCCCCTCCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCGA
CGGTGGTGGCGGTCCGGGAAGCACCGGCGGCGCGAATTGCGCGAACGAGTCCCCAAAGCCAGGAGAGAAAAAGCGAACGACGTCATGTGGAGCTGTGCGC
CAAAATGTCGAGTTGTTCCACGGCAATGCCGTGTCGGAGTCGGGCAACTCGCACTGCCGTGAGAAATCCCAGCCAAACAGCGCCGACGTCGACGCGTACA
CTTGCTGCAGTTGCCATTCGAGCTGCGTGTCGTCCTCGAAGCGGCGCTGCTTCGCCCACCGCGCCAAATCCGGATCTTCGTCTTCGTCGTTGTCGTCGTC
GTCAGTTGATGGGTCCTGCGCCATCCGCCCAAACGCGTTGTCGTCGTCGTGAACTACGTCTTCGTGTGGAACGCGAATTATATACTTGTCCAGCTTACGT
TTGCCCGTCATTGACTGTAGCTGCGGTGGCGCTTGAGGATGGAACGCCGCTGCATTCGGATTCAAGACCGATCCAGTGTTGTCAGGCTCCTTCTCTGGCT
CGGTCTTTTCGGCCACTACATTTGAAGCGCTGGCTCCATCCAATTCCACTCTTGCCGGTTCAGGCTGGGGCTCGGATTCATCAATACCGGCCGCGACGCT
GTCGATTAGCGAAGCATCCTCTGTATCTTGACCCTGTAGATCAATGATTTCGTCGCTACCTCCGGATTGAACGCCACTTTCCGAAGGACATGACGATGGC
AGGGACTTGAGAGCCACAACGCCTTTGGATTTCTTCTTCTTTTTCTTCTTCTTGCGACTGTTGTGCAGAGCCTGCATGCCTTCAGCTTCACAGGACTCTT
CCAGCAGGAGCGCTTCCATTTGCTGAGTCGCCTGTTTCTCCAGGTACACAACGTAGCTTCGCAGGATGAGCTGCAGAACCAATTGTACCTCGTCAGCGAA
CTCGACGCCATCTCGATTGTCTGTATGCACACGACGCGCACCTGTTCAACAAGCATCGCAATGAGGCGCTGGTAGTCCTCCCACGTGTTGATGACTTCGC
TCTCGGTGACGAACAGGTCGTGGAATTGTTGCGCTGTCAGCACATGCACCGATGACAGGAAGCCCGTCAGGGCATCGCCCACAAGCGAAAACAGTCGCTC
CGAGCTCTCCACCAGCTCGTTCTTGACGGTCAGGATGCCTGCAGGTAACCATCAGCGCCACTATCGATATCGATCCGGGAACAGAGTTATTGACACTCAC
CTGTGCCGATATCCATGAACTCCATCGCCTCCAGCAACTCGTACGTCTTCTCGGTCGGATCATCCGTCGCGGTTGGCGCCAACATGGATCGTGTAGGCGA
CGATCCAGCCGCCTTGTTGGCAGTGTCCACACTCTTAGTCGTTTGCAGCTTGGGTTGTGACACTGAGGCTGCAGATGCCGGTGCCGTTTGCCTCTCGCTC
TGTGCCGTGGCCGCTGCTGTCCGCGCCTTGAGGTGGCGCTGCATCAGTCCCACGCAAAGCAGGCTCAGATTGAGCTTATAGAGCTGCTTGACCAGCTCAG
GGTCGTCCAGAAACAGCACTTGCTGCCGCTCGCTGGCACTCAGCTGATCCCAGTACTGCCGCACGCGGCCCGCGCTGTTTCCCGTGGCGATCGTCGCCAG
CGGTAGCTCCACGAGTTTGCCAGCGGCGACCGACGGCTTACCTCGCTTCATGGAGCGACTGCTAGTGCTCGAGCGGTCATGTGGCAATGCGGGTCGCCGC
TTGTCGACGCTTGCGCTGCGAATAGCGAGGTAGCTTCTCCAAATTGGTGCTATCCTCACACAGCACGGCATCACACAGCCCGTTCAGTCAAGGCCACAAC
ATCCAACGGCGGCGGCGACGCCTGGCGATGCCGAGTACGAGATCTCGGGCTTACCATCAACTGCGACGGCCGCCTTCTTGACGGCGGTGGCGCGTCGCAT
GGCCGCGCCTGCCATCGATCGATTGATCTCGAATGTGCCTGCTCGCGTCCATGCTTTGACAAGCTCCAAATAATTGGCTCCCCGGTAGTCAATTATTGTA
TCAGTCAGCCTGCATTCCAGCAAGATGCCCATCATTCCATCGTGACCACCAAGGGAAACATGGCCGACGCGCAGCATCGGCGCGTGGCGCAGGCGCTCAA
GGCGGCGTGCGAGGAGACGGCAGCGCAGGCGATCGCGGCGACCACGGCCAGCGGCCAGGCGTCGCGCGTGCACCACAAGAACCGCAAATTCGGCAGCCGC
AAGGAGGCCAT