Description :
From Genome Similarity Track
Location :
Scaffold_269:7774- 11434
Transcript NameFunction/comments
Phyke_g8875hypothetical protein
Phyke_g8876hypothetical protein PHYSODRAFT_258132

Sequence
3660 bases(100 bases per row)
TCACACGTTTTCAATATGCTTGAAATTTGCAGCACTGTTTTCCAGATCAGAGTGCATACCTGCAGTCTCCGCCATGCTGCTCGAACCGGATCGGAACCAT
TCCAGTGCATATTCCTTGTTCTTTTGGAAGCATAAGAAGGCCTCGACCATTGCTGGACTGTCAGCCAGAGCATTCTCACGGCCAAGGCCCTCGGTACGCA
GAAGCACACTGTAGACGTTGTTGCGGACAGATTCGCCActcgacgatgaagccggCAGCGACAACACCATTTCAGCGTACGGCGCGATCAGCGGAAAGCG
CAGTTGGTTCgtcttccaccacgtcaACGGGTCCACGTTCCGTTCCGCAACAGGAAGACTCAAGAACGCGCTCAGCTCTTTCTCCCAAGTCGCCACCATT
TCGCTATCATCTTGCTGTGACGTCTTAGACGACCCTGATGGCAAGTGAGACAGTAgatcatcctcttcatcatcagcgaGTTGCACGTCGTTGCCTGTAG
GGCTAGACGACTTTAAGTCGTTTTTAACCAGCTCAGCGTAAGAAGCCGTTGTAATCCTAACCACACTGTCACTAGAATCCACACCTCCTGCTAGTGCAGA
GGTGCCAGAAGCACTTGACGACTGTGTTGACTCACCGTCAGGGGTGAACAAACGACGGAGATACTCCTTACCAACGTCACACTCACTTTTAGGAGACAGG
TAGCAATACTCACGATTTTTGTAGCGCGGGTCAAAGAGTGTCGCCGCGTAGCAAATCGGTGGTAGCGTCATAAAATGATCACGCAGCTTCTTAGCCAACG
TatcgaagaagcgcttccaCATTGCTGGATCCAGGTGCGCTGGTACACTCTCGGTGGCTGATAGCCCTTGCTTCTCTGCATATGCTACGAGAGCTGCCGC
AATGGTTGAAATGCTTGAAATACCGCTCTTGTTGACCTCCTTATCGCTGCCTGTCTTTCTGCTCTTCTCTCCTTCCAGCGCTTCCGAGTAGCGTGAAAAT
GGCCGTAGCTTCTTCACAAGCAGACCAATGAACTCCACTGTTGTTATCGGAAGGTACTCCACGAGATGTGCATTTGcgatctgctccagcataGGCAAAT
GTTCCAGCAAGTCACGCAGAAACTCATAGTAAGACATTGACTCGTGTCCTTCAGGCGAGAACTCCACGTTAAAGAGCGGGGACTTGCGGCTAAGAGAAGA
TATCGCCTCTTCATTCTCCGCCAGCCGAGCCGCGAACTCCTCCACCTGATGCACCACCTCGGGGAACGACTTAGCAAATACCTTCTTGGTCAGGCAGAAG
CGCAGATGTTGCACTGCTGATGTAAGCAGGAGCGTGCTTTGTGCCGCATCGGGGGACACAATCCGGCCGTCAAAGTTTGTCGGTATGAATAGAGACGGGA
GGTCGGCCGCCGTCACCTCTACGTTGACAGACATATCGTCCTTGACACAGGCGATGACCTTGTCTTTTACACCCAAACGCTCCAAGTACGAGTCCAAGAC
GACCTTAATAGTGTCGAGTCTGGCACCGTCATCAAGCGGTGCGCAGCCGACCGCAATTTCGAACAGCCGAAAATTCACGCTGAAGTGAatcttcaccacc
aaataCTGCGTAGGCTTGGGTTTCGTTGGAGACGGATGCTGCCATCCCTCAAGCGATACCGTCACACTTTTAGCGCGACCCACAAGCATCTTCGTGGTTA
GGAATACACTCTCCTGTAGCAACAAGATGCTCTTGCCCAGTGCATCTTCACTCGGCAACGGCAGCTTCTTGTCTCCCAGTAACTGGTTCATCACGTACTG
CATACCTGGCTTAGAGGTAAAGTTCAACGGCAAGTTGTCCATAAGCGCCATGAGCGCCAGATCTTGAGTGAATTGCTCTGCATTTACCTGTACAGGCTGC
ATCCCGTAAGCTGAGCCCAGTACTTCTCTCTGTTCTTTTGAAAGagtcactgcagcagcactggctTGTGGTGAGTAGCTATAGAGTGCACCGGTTGCAT
CCCGTTTCAGGGCACTATTGAAGCCTCCAGCGGCCGCTACAGCCGCTGCAAGGGCTTGAGAGGCTGCAGGGACCGGGTACATGGCCGCAGCCATGAATTC
CGCGCCCGTTTGGCCCGCTGCAGCCGCCTGGAGCCCCATTTTCTGGCGCTTGATATGACGCTTGGTCTCTCGATGCTCCTCGCACACGTTGTTTGCCTGT
TGGTGCGTGGGGTCCGTGCGTCCGGCCGTGCGCAAGTGACTCAGCAGATTGGATGAGTGGTAGCCCTTGATCACGCGCTCGCAGAACTTGCAGATGGAGT
TGCCAGTCGAGTCCTTCTCGAAGTATGTCCAGACGGCTGAGACGCTGGCAGGACCGCTGTTGAGAGGCGTAGTGCCATGGCTACCAGACGCTGGTGAgga
cgacgcagcagaccCAGGGAATTCCGAGGACCTCTTCACCATTCTACCGGTACGAGAGCAGGAAATCGGTATACGGTAAAGTTGAGGGGGCCAAATACTA
CTTGGTCGTAATACGACCAAGTAGATACCCAAAATCTGGATTTAAATTAGGTCAACTTTTTGGTGACATCTTGAAGTGAGAAGGCCATCACCTGCCTGTA
TCCATCGCCTGTGCTAGCAGCGTCCGAGCTACGAGATGCTGAGCCGAATCTGCATTCGTTCCGTTCAATTCGGACGGCGAAGCTTCGCCACTCATGTCAC
TGCAACGGTGGGCTTCATTGGTCTGGGGAATATGGGATTCCCCATGGCGCACAACCTTCTCAAGGCAGGGATCGATGTAGTCTGCTTTGATACGAATCGT
AGTAATATCGACCGCCTCGTGCAGTTTGGAGCGAAGCCTGCCACTTCCATCGAGCAGGTCGCTGCCGAGACAACTACAATTTTCTCTGTTCTACCCAATG
ATGAAGTCGTCACAAGTGTCGTACTGGGAGACGACTCAAAGCCTGGTTCAGGTTTGCTGGCCAATATGACGCCGGAGGTTCTACATATCGGATGTTCAAC
GATCCACCCCAACACATCCCGCTTTCTGGATCTCAAGCACAGTGAGGCTAAGACAGCGTACGTTGCGTCTCCGATCTTCGCACGTCCTGATGGAATGGAG
GCTTTGCAAGCGAACTTTGTGTTGTCTGGATCGGACACTGCCGCTGTGGAACAGGCGGCGCAATTCGTGAACAAATGCACGACTGGACGCGTTGTCACAT
TCAGCACGGAAGATCCTGGTGCGGCGAATGCGGTGAAACTGTGCGGCAATTTCCTCATTGCGACAGCAATCGAGTCGATGGCGGAGGCGTTGTCACTTCT
GGAAGCCAACGGCGTGGATCGCGTGCAAGCCATGGAGTTCTACAGCAGCACGTTCATGAACTCAGTGATCCACAAAGGCTACGGCCAGCGCGTGTCTGAG
CGTGACCACCGTCCCGGAGGTtttgcactggagctggGCTACAAGGATCAACGCCTGGCTCACCAGATGGCCATGGAGGCTCAGGTACCGATGCCATTCT
TGTCCACGCTCATTGACCGCTTCCTAAGCGAACGCGCCAAAGGCCGTAGCGACCTCGACTGGTCTGCTATTGGTCTCGGGGTCTGTGAATCGCGTGGCGT
CGACGTGTCGGAGGCCATCGAGAGATCTCGCTCAGGGCAGACGCCTCTATAACTACAATA