Description :
From Genome Similarity Track
Location :
Scaffold_77:77727- 78788
Transcript NameFunction/comments
Phypa_INRA-310PPTG_17946ATP-dependent RNA helicase eIF4A

Sequence
1061 bases(100 bases per row)
ATCGAGACCTTCGACGGCATGGAGCTGCGTGAGGACCTGCTGCGCGGTATCTACGCCTACGGTTTCGAGAAGCCGTCTGCCATTCAGCAGCGCGCTGTGA
AGCCCATCCTTCTGGGCCACGATTGCATTGCCCAGGCTCAGTCCGGTACTGGTAAGACTGCCACGTTCGCCGTGTCCATCCTGCAGAAGATCGACATTAA
CCTTAAGGAGACTCAGGCTCTGATCCTTGCCCCCACGCGTGAGCTGGCTCAGCAGATCGTTAAGGTTGTGGTTGCTATCGGCGACTACATGAGCGTGCAG
GTGCACGCCTGCGTCGGTGGTACCGCTGTGCGCGACGACATCCGTACGCTTCAGCAGGGTGTGCACATCGTGGTCGGTACCCCCGGCCGTGTGGGTGACA
TGATCAACCGTCGTGCTCTGCGTACGGACGAAGTCAAGATGTTCGTGCTGGATGAGGCCGATGAGATGCTGTCTCGTGGTTTCAAGGACCAGATCTACGA
GGTGTTCCGCTTCCTGCCCGAGAAGGTGCAGGTGGCTCTGTTCTCGGCTACCATGCCTCTGGATGTGCTTGAGGTGACTCGTCGCTTCATGCGCGAGCCT
ATCCGTATCCTCGTGAAGCGTGACGAACTAACCCTTGAAGGTATTAAGCAGTTCTTCATTGCCATCGACCGCGAGGAGTGGAAGTTCGACACGCTTTGCG
ATCTGTACGAGACGCTGACCATCACACAGGCCATCATCTACTGCAACACGCGCCGAAAAGTGGACTGGCTTACCGAGAAGATGCAGTCGAAGGACTTCAC
CGTGTCGGCCATGCACGGTGACATGGAGCAGCGTGAGCGTGACATCATTATGCGCGAGTTCCGCTCGGGCTCGTCGCGTGTGCTGATCACCACGGACCTG
CTGGCCCGTGGTATCGATGTGCAGCAGGTGTCGCTGGTCATCAACTACGACCTGCCCACGAACCGCGAGAACTACATTCACCGTATCGGTCGTTCGGGTC
GTTTCGGTCGTAAGGGTGTGGCCATCAACTTTTTGACGCACAACGACGTGCGATACCTGCG