Description :
From Genome Similarity Track
Location :
Scaffold_12:77715- 79849
Transcript NameFunction/comments
Albla_Nc14016480conserved hypothetical protein
Albla_Nc14016490conserved hypothetical protein

Sequence
2134 bases(100 bases per row)
CTTTTATCAATGTTTTTATGATACCATTTTGGTCGGGCAGATCGGTAGGCTCTGTCACGCCATCGATATCTTGATACTCTTCTTGACCACGAGGAATCAG
GACTTTGTTCAAAAAAGAGAGAAATGCGGGATCTGATGTCTTCACGGCGTGATTTTCGATAAGGCTGGTGGTTTTGTTCAGTAACACATTCATATTTCCG
GATCCATGATCCAAAATGCTAAATATGTCAGCACTGCGTATCTTGAGATTTAAACCTTCCAAGAAATCTAGATTTACGAGTTCGGGACAATGTTGAAGGA
TAAACACCGCTGTTTTCTCGTCATCAAACTCCCATGTCGAAGCGAATAAGCGGACAAGTTTGCCTACTTCTAGTAATTCCCATTGATCGCGTGCTGCTTG
ATCGATGAGCTTGGAAAAGGTATGATGCATATTGGTGACATCAACCGACTCCAGAACTTGTGTTTCGTCTATTGACTTATCAGTTGATATGAAATCTTTG
TCTTCTACTTGATGAAGAGCTGCTTCCAGCCCTGATGTTTGCGATTGTCCTATGTCCGAGATGTTTTTGTTTTCATTGAGAGCTTTGTCGACATTTTTCT
CCTGTTTTGATTCTTCTTTGCTGGCAGATGTAAAATCAGTTTTCGCTGTGTTTGCCGAGCTGAATCCATTTGTCTCGATGAATAAGTCGTCAACGTTAGC
TTTCATGACAAACTTTCTGTTCTTTCTTTTTCTTTTTTTCTTTTGTGAAGCCTTCATATTCGTAGATATGACCTTAGGAGGAATACAATCACCTTTCTTT
TCTGAATTGGCACATTTGTTACTATTGCATAAACTGACCACTTCTTTTTCTTGATCTGCTTTTGCTGCACTATTGCCGCTTTGATTAGTTTGGCTTATAC
CATCTTGTGCTTCGGGTGATTTTTTTATCTTCCTTCCAGCATCAGTAGCTAGCCTTTTATTGGCGACGGATGCCACGGAGGGCGGCTGCAACAATCCACT
TGACAACGTACTTTTGTTCAGTGTGTCTAATCTATCGCTCTCGCTTGATTTTTTTCCTATCTGCTGCTTTAGACTAGATTGATATTGAGCTTGCTTTTGA
TTCGACTTTTGATTTTTCCATACGAGTTTTGGAAGAACAGCTTCAGAGTCGATTTCATCATGCACAAATTCTCGAAAGCTTCTCTTCCTTCTTGTAGACG
CCACAACACTTGACTGCTTCTCCGTGATATTCGAAGCGCTTCTCGTCTTCCTTTTCATCTCTTTCTTGCCGACTTTCCGATCAAACGAAGGCTTTGGTGT
CAGCGATGCCGCAGCAAGAGCATCTTCCAGTGGATTTTTTGCCATTCGTTCGTATCTATAACCAATCCCGAAGGCATAACCGATTTTCAGTTAAATCTCG
TCACCGTAATGTAGTATTAAAGACGGTTCTGCTTCATTATTGGACAGTAATTTATACTATGAAAAGCTCTGATAATGTAGCGCTAAAATGGACCGAGTTG
GAAAGCCACGAGCGAGAAGGGAGGGAGCGAATAAAAATGCAACGTGTCGAACAATACGTACGCTTCAAGCACGACTCTTTCGTGGGCTTAAAATTTTTCT
AATAGCAAAAATTAGCTCATGCGAGGATGTTTCCAAGGCTTCGTGTTGTGATCGATTTGTCCTTCACTTCTGAGCAAACTCTTCGGGTACCTCGTTTGAT
GTCATTTGGGCTTATCGGCATGCTGAGCCCAAAACGATCAGGAATGTGATAGCCTTCTAAAACAGCTCTGCTGTGCGTATGGCTACATGAGAGCGTGCCC
GCTGAGCTCGATTCTAAGCCTCGAGCTGGCTTCTTACCTTGGAGATATCGTACCGTTGTGCCAAAAGCATGGCATTTCCAATTGGCCTGTGAGATTGTGT
CGCTACCTCGCATTCAGCCATGCTTACGACCTCTTCGTGTTTAGATTATGAAGCATTCGATCTCACTTGACAAAGCCTACCCCTCCAAAGATTTAATTTA
TCTCTCACCGGATGCATCCTACGAGCTCGAACATATCGATGACACCAAAATCTATGCAATCGGTGGAATTATCGATCGTACTGTTCGCAAGGTAACTTGA
ACCGCATATGTTTGCTCACAAATTACCAGCCTCT