Description :
From Genome Similarity Track
Location :
Scaffold_282:7771- 10715
Transcript NameFunction/comments
Hyaar_Emoy2813487hypothetical protein

Sequence
2944 bases(100 bases per row)
CTTCTGTAAATTATCATGTAACGGGGGCACCCCGTTACATACCTCGTTCCTACTCTATCGCTGGCTCTTTTTTGCTTGTGCTTCTGCCACTACTGCTCTC
TTTTGGTGGGTGCAATTGTCACCGATCAGATCACCGGCTCCTGGAAACGACATGTCTGCATGCAGCTGTTGCAACAGATCTCCGTCGCCGTCGTCCAGTG
AAGCCAATATTCAAGTCCTAGTCACAGGAATACGTCACCGTTCAGTTCCTACATATTTTCAGTCCCTTTATTCTTCTTGCTGAGAAGAGCGAAGTCTATG
TCCACGTATCGACAGAATTGTATCTTCGTACTTGGTAGCTCTTTTTTACAGAAACTGGTAAATTGTCGAATCACAGGGATGCTGCAGCTTGCGCGTATGG
TTACGCGTCTTGAAACGGGGTAAACCTGTTACATGTAATCAACCCTTGATACTTGTTAATTAGAATATTATCATAAATGTTGATAATGTTCGTGAATATA
CCATAAGGGGTAATATTATGAACACTCACCGATTGGCTGATACGAGTGACTATATCAGCCAGCTCTAGCGGTCCAATCAACGACGGAAGAGCGCAATGAG
TGGTGAGCAAGACTTTAGCATACATTTTTGTAGACAAATATAATTAAGTTAGGACTAAAACATAGGTTAATGATTGAGGACTTAATTATATATAATACAG
TCTTACTTTTACCAGCAACTAGTCAGTTTCTAGTTGTAACGGGGTAAGCCCGTTCGATAACATTGGTACGAATGTATCAATTTTTTGAATATTATCTATT
TAGATGATATTCAATTTACATCATTTGAGAAGAGGTAATACTGGCAGAATATTACCTCCGGGGGTAATATTCTGGGGTGCTCCCCTTTTCGTTGAGGTAG
ATACAAAATCAACCAAATTAACCACCAATCGCTGCTGGACGCGCGCAATGGGTGGTGAACAAGAAACCATGTAGGAGGTTTCAGTTTAATATAGTTAGAT
CAAGACAAAGACGATTTACAAAGAAACGTAACTATATTAAATACAGTTCTTGTAACGGGGTTACACATCGTAGGGTACTCGGTACCTGTGTCTTAGACGC
ACGGGATGGTATCCCACTGAACGAGACATAGAATATCTTATCGGTATATAGGGGCTGACGGGTGTCAGCCACGAGATAGGAAAGATCTCGAAAGTTCTTG
ATTTAGGACATGAGTGCCTAGATAGGTAATATTAGGATTGAGATATTCTATAGAGTTAAACATAAATAAAGTTCAGTTCACTTTTCGGTCTTATCTAAGA
CACGTGCCTTGCGAGGCGTCTCTGATCGTTGATCGTTAAGAGTTAGCAACATCTCTCTGAGATAGCTAATCTTGAGCACTAAGTGCTGTAGATTCACTGA
ATCGTTCGGTTCCCTGGAACAGGGACCTTAAGCTTTACGCTTGTTGACTCAGTCTAGTTCTTTAGAACTAATATCGCTCTTTGAGCGCTAAGTCTTCCTC
TGACTTAAGGATCTGTGTAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACGCCTGAGTTTTTAAAGACTGATCCTCCTTGAAGATGGAAAACCT
CACTCCCCTAAACCCTGAGGCCCAAATGGTCGCGCTTGATAAGCTGACCGCATCTTTGGGTCCAGAGTATGTGGAATTCCTTGTATCGCAAGGCCCGGAG
GTGCTGACTGCACGTGTTGAGGNCTTCTTCCANTATAAANCNTCCCTTCTANNCCANNTCCAANACCAAATNNCTTCNNCTATNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCGACAACATGGTTGCCAGTGGCAATTGTCTCTGATAACGATCCCCGCTTCACTGGGAAGTTTTGGAAG
TCCATCTTCAAGGTGCTCGGCACCCGTTTGGACTTGTCCACAGCGGATTATCCGCAGACTAATGGTCAAACTGAGCGTGTTAATCGCGTCATTAATGACA
TTGTACGCAGTGTTTGCGCTGATACGCCTATGCGTTGGAGATCC