Description :
From Genome Similarity Track
Location :
Scaffold_67:77703- 81615
Transcript NameFunction/comments
Phypl_g2297hypothetical protein
Phypl_g2298PREDICTED: hypothetical protein

Sequence
3912 bases(100 bases per row)
TCGCAACTCACCCGTCCGCGGAGCGGCTAGCGCCTTGATCATCAGGTCCGCCGGCATGCGTTCGGTCTCTCGGTACTCCGACTTCAGCACGCCTCGCTGT
GTGAAATCGCCCACGAACTTGATGCGCACATCAATGTGCTTGGCTTTTGCGGACGATCGCTCGCTTTCAAGTCGGTTTAGCGCTACTTGGGTATCCACGC
CCAACGGCATTGGATGCACGTACGCAACGCCCAACTCTTTAAGAAGCTCGCGTTCACCGAGCAGCTCTTGGGCCATGACGGACGCAGTCGTGAATTCTGC
CTCCATGGTCGATAAGGAAACCCCGCCCTGCTTCTTGCACATCCAACTGATAGGCATGCCGTCCACTGTGACTAGGCCTCCCGTGACCGATTTTCGATCT
TCTTTGTTTGCGGCGAAGCTTGCGTCGCTGTAggcgacgacttccagcgGTTCATTATCCTTACGATTACCTCGCATCTGCATCCGCAGGCTCCTCGTGC
CAGACAAATATCTCACAATCCGCTTGGCCAATTTCCAGTCGCACGCCGTTTGCCGATTGGTGCGTCGCGACGCCTTGTGCACCGCGAATGCAATGTCGGG
CCGCGTGCATCGCGCGACCCACAGCAAACTCCCGACCAGAGACTGGAACTTCGTCACCGTGACGACGCCTTCACCACCAGAGGCAGGAAGCTCCTCAAGC
CCCGACTCTTGAAGGCTATTCTATTCTTCTCCTATGGGGGTGCGCGTGTTCCATACCatgctccttcttcatctcggtGATCGTCACCTCCTGGTCCAAA
TCATAtccgtcctcgtcggagTAGTAAACACAAATCCCCTGGTATTTGCGCGCGCACCCTTGATCCTTGATCGACAGAGACGCAAGCTCGCCGAAGAAAG
CATCTACTGCTTGCTGTCTCGTGCCCGTGACGAACAGATCGTCCACGGATACACCCACGACCAAAAGGCTATCCCCTTCGCGCCGAAAATACACGCACAT
ATCGGTGAGGCTCTGCTCGAAACCGATCTCCGTCAGCTTCCGGTGCAGTAGCTTGCTCCACAACCTGCCAGCCTGCTTCAACCCATAcagcgccatcttg
agctccaaCACCAACTCGCAGTCGTCCGTCACGCCCAATTGTTGCTTGATCGCCTCGGAGATTTCCATCCCCTGCGGCACACGAATGTAGATAGTCAAGT
CCGACTCCTTGCCCGCGTTCACGTAGGCGTTGGGGACATCCCTGTGCTTGACCGGGACTCTCCATTTTCTGGCCAGGACAAGATAAGCTTCACGCTCGAC
ATGTCAATCACCACAGCAAAGGTGATCCCATAGTTGACGCCGAACTCTTGCTCGTTCCAGCAGGCAACGAGTCAAGCCTTGAGTCGCTCGATAGCCCCCT
CTCTGCATCTCGATTGGTCTTATACACCCACTTTGTGTGGAGGGCTCGTATTCCGGGTGGTAAGCGCACCACCTCCCATACCCCGTCCTCTTCAAGAGCC
TTGAGTTCGGCTACCATGGCCTCTATCCAGCCaagcttctgcttgctgcgCATAGACTCTCCGTAGTGTTTCGAGTCGACCTCGGCGACGTTGTTCTCCA
CGTCCGCACGGGTCTCCTCCTGACCTGCGTGCCCCTCAGTGTTTCCTACCGCATGTCGGCTCGCCGAACGCGTCACTGGGTGCTCCCTTCTCTTGGAAGA
CTTCTCCTTCGATTTATTGCGGCGACCTTCCGCGCCTCGCGCGCTCACCGCgtgcccagctccagcaggctGTTCTTCCTCGTCCCGACGTTCAGCCTCA
GTGTCTgccgtgtcgtcgtccaggtaCAGCCTCTGCACCTGCTCGTTCTGCGCTTTGTCCAGCGTCTCAATGTTCCTGACGTGCTGCGTCGTGACGACGA
TCTTGTCCTTCGGCAGGTACACTCGGTACCCTTTGGTCTCCTCGCCAATCCCGACAATCATCCCCTGCTGCGCGCGTTGCGCGAGGTTCTTCTTGCGCGG
GTCACGATACACCGTACACGGTGACCCGAACACTACGATCTCCCCGAGCGGCGGGGTCTGCTTCGTCAGGACCTTGATCGGCGATGCGCGTCCAGTGTTC
GAGCTCGTAGGAGCTCGGTTCAGGATATACGCTGCGTACTGTACCGCGTCACCCCAGAAATTGAGAGGCAGGCCGCACGCGAAGATCATGCAGCGGGATG
TGTTCATGGTGGTCCGGTGCATCCGCTCTGCCTTACCATTGCTTGCCTGGTTTCGCGCCGCGTTCCGCTGCCGCGCGACCCCCGTGCGCTTGCAGAAGAG
ATCCACGTTCTAGTACTCGCCCCCGGAGTCTGTGCGCAGCACGTATATGCGACAGTTAAAGCGCTTCTCGAAGAACGTCAAGAAATGTTCAAACATcttg
gccgccgcgtccttcgTTCGCGCCAAGAAGACTCGGCAGTAGTTGCTCTTATGGTCAACGAAGTTGATCACGTAGCGGTTGTCCAGCCTGCCCTTGGGCG
TCATGGGCCATTTGAGATCCGAGCAGATGACGCCTCCGACGCGGTCGATTGGCGAGTGGTCAACAGTGTCCTGGGTTGACTGTCGGTTCTTTGTCTGCTT
GCCCTGAGCACAAGTCAGGCAATTCACACGCCGGTGGTCCGCGAGCGTGATACCCGTCTTGAGATCTCGAGCCAACCTCTCGACCGTGTCGTAGTTCAAG
GTGTCCGAGGCGCTTGTGGAACTCAACCAGTGTTCCCTCCTGCACGTTGAGCGACACCCCTTCAGCTTCGGGCGCGACCGCGGCGCGATCCAATGCCGTC
ATGATCACTTCTGAAAGGGGCCcttgcttcttctccacgctcGCAgacaccaccagcacggTACTGTGCAAGCTCACATCAAACGCCACGCGCCCGCCAT
CCTTAGCGGCTACGACTCGTCGCCCGCCCATGTACGTCAGCATGTAgcccttcttgtccagcgtcCCGTAGGAGATCAGGTTGTGCACCGCGTCCTTGGG
GTAGTACACGTCGGTGAGTTTCAACGTCTCCACCAGCCCGCACGCTGTTACTCGAAGCGTCAGCTTTCCCTTCTTACTGAtgttcagcagctctccaTCT
GGCTGCAAGCACTCGTCCTGGTATAGCTCCACATCGTCCAACCAAGACGCATCATTGACCAGGTGCCGGCTGGATCCGCTGTCCAGGATCTACAACTCGT
CAGTCCCCGTCGACACATCGTTTACGGCCAACGTTAGGTCCAGCTCTCCGCCGCGTCGGCGGCCGCAGTCTGGACACGCAGCCTTCAGATGCCCGACCTG
CTTGCAGTTGTGACATCGACGAGTCTTCTTTCCGCGGCGTTCCGCCACGGCGCCGACCACCTCTTTCCAGAGATTTCTGTGCCTTGCAGGATCCAGTTCC
CATGCCGGAGCGAAGTGCGCCAGTTCttccgcctgctgcaggaagtcgATCCTAGACccgtccaccttggccatTAACATTGCGCGCAGATCCGCAGACG
CAAACTGCACAACGTTGTTCAGGACCACCACAGGCCTCCGAGATCGCCATCAGTGCTTCGGCCAAGTGCGCTTGTTATCCTTGCGCGCCGTGAACAGCTG
TATTGCCTGTGTCGGCGTGATGTTTGTCTTGAACGCTTCGAGCATCCGCTCCATCACGTGCTGCAACGTCGGTAGTTGCGACCACCAAATCTCCAACTGC
TTGTTGTAGTAGCGCTCGGCGGTACCGGACAGGTAGTGCCCAAGCAAGTCCACCTTCACGTCCTCGGGCCACACGATTCCGCAGGCCGACTGCGCGAGGG
CCACCTGTCTCTAGAACCTCCGCCCCCACTCGAGGAATCCAGACCCGAGCCCAACGTAGAGCTCCGTTCCATCGAAGGGGCGGATGGTCAGTTTCTTCTG
TCGTGCGTCGGG