Description :
From Genome Similarity Track
Location :
Scaffold_15:77694- 84313
Sequence
6619 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATCCACTCCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCC
TCCTCCTCCTGGCCCACACGCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCGACTCACATCAAGGTATCCCCTCCCTACTCTTCTTCATGA
GACTGCATCACGCCCGAAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCGCAGTTCAGATCTGCCTTGTCTACCCAACTCGG
CTCGTCATATCCGCGCCAATACACTAGAAATTCACGGTAAAATCGTCCGTATCTAGTTCGTTTCCATGACCTCATATCGGTGATCTTCTCGACTTCGAAC
TCGTCGTCTTCGAGATCCACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAAAGACGGATCTGCGGCC
GATCCGGGTATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCTTTACCGCATGTCCTCC
AATCTTCTCGCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGGGCGTATCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCC
ACTTGGATTAGATGTGGACGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCTGGT
AGTATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCA
CCCATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTTATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTCTGA
TCCAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGTACCATGCGTTCGGCCGACCCGTTAGCTTAATGACGATATGCCATGGTTGCTCGCT
GTCGCTGCCCTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAA
AACACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAAT
TCTGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGGACATTCCCAGGTGACTCCCCTT
CGATCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCTTCTCCAATGGAAACATTCCCGGAT
CCGTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAATCTC
ATCAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCCGTAGCGATAACGCTGTAGG
ATTTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTCTGTGCTTTGAGGATCCGCTC
GATGCGAACTCTCTTCACAAATGTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTGTCCTTTTC
CCGGATCCAATCACTACCACTTCGTCAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCACTTCGACACCACATTGATTCCGTAAAG
CGGCACTGGCCAAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGTACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCG
TAACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCGTTTTGGATCTTGT
CCCTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACTCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATC
CGGGCAATTTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTAC
CGTCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCTTAGTCAGCGCATCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCC
AAGACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGTGAGAGTAAAGCTGCCCACTGTCCCAAACGTCCTTGCAACC
CGGCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTATAATTTAGATCCAACACGCGCAGGAAG
CGCAAGTATCTCTTTCTCCACCGGCTCCGGAAGTCCAGTCATTCCGGCTTCGGGGGTCCGGCTGACAAAAGGGAACTGTGATTGACAGAATCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCACGGGAC
GTTGAGAACTGATGATCTTGGCTTGCAGCAGGCCTTTAATCAGATCCGATAGTTTTCTCGGAACTGAGGCGCCACCTTCCGCACCCTCTGAGCGATCGGT
TTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTGCCAGATTTTCT
GACGCAGACGGTCCACTTCAGCAGATTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTGTGGTCAGTGGTACCTCCGGGATCAC
CGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCATGGTAACAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAA
CACCGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGTCAGGTACCCTGGTATCAGGGAAATCACCAGTTGGATCTAGTCGGTCCTCTAACGA
GTTTAAGCCCGACGGTTCTGGTTGGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAAAGCTTGGATCCACTTGTGGATCAGCG
GGATCCGGCTGTTCGGCATTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCGTGGATCCAA
CCTCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCTACCAAGGGGCCAGTTGGCTCCGCCGG
GAGCTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGT
CGCCTAGGGATACCGTCCTTCGTCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCCTGTCGCTGCCGTTCGTGACCTGGAGGTATCGTG
ATCGACCTGGTCCCTTGATTACGGTCGGCACCCATTTCTCGCCCCTAGTGACCCACAGTTTCTCATGTTCCACCCACCTTAACCGATCTGGCAGTTCCCA
GGTTTCCCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGATCCTCATCTTCGCCCCATACAACGGTCGTCGTCCGCTGAGCTGGATCCGCATCTCG
TCAGGGAAACACAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCAGCGAGATCTCCAAC
CCAAATGTTAAACCAATACACCAAACAACCTGCCAGCGTGACCTTGATTCGCGTTCTCCCGTTTGTACGGTACACGCCTTCACCAATCCCAACACAATCT
TGGATCTGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTT
CATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCCTGTCAGCAGATCCATGGA
TCCAACATCCTCAAATCCACGGGATCAAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTTAAACCATCGACCATGTTGG
CGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACATCGGATCTGGCAAACTCATCCACTTGGCGCAAACTAGAGATCT
TGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATGCATAAATGCA
GTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTTCTGGCAACATCCCTCGGTGCTTGGCTC
GATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACACCCGCGATACACGTAGAAGCAATGATC
CCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGGGATCCGCACTGCGAACACCTGATTTGC
GCTGTCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCGCCGGGTACGGTATCCCCCGATCGAGAGCTGTCTCCAGTCTTCGCCGTCCGATCGT
TGGGCGCAGTGAGACAGACTCGGCAGTAATCCTCTGGGTCGGAGTCCTAACCGTCGGATCCCGATTCAGTTTCTGCGTCGGGCGCCGTGACTTGGTGGAC
GCGTTGAGCTGGGACCGTGGGTGTCGGAACTTTTTGTCGATAATTGCCGGATCCGAACGCCGCCTTCTTCCGGCGGTGTTTCGCGCGATCCACAGGCCGC
AGCACTTCTTCGAGCTCATCTGCGTCTGGAAGACGTAACAGGGTCGGCCTGTCGGCCAGATTCACATCTCCCAACGTCTCGATGAAATGATCCACGTGTT
CCCGTAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGCAGACCGGCCACATTTAGTCGATGTAGGTATTCTAGCGGGGATTCATCCGATCT
GCGGCGAGCGTGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGCTTGGAAACTGTGCAGCAAATCTGGCCACTTGTTCCTGGTGGAT
CTGCCCAGCTGCCGATACC