Description :
From Genome Similarity Track
Location :
Scaffold_208:7769- 13746
Transcript NameFunction/comments
Phyra_85510putative sphyngomyelin sunthetase, partial
Phyra_85511Hypothetical protein
Phyra_85512pyruvate dehydrogenase [lipoamide]

Sequence
5977 bases(100 bases per row)
TGGAGGACTTTTCTGGAGAAGCTGCACTTCTTCTTGGAGTTCGAGACCGCGGGGGACGCGCTCGCGTGGCTTGAAGACGGCGCGCGCTTTATCGTTCATC
AAGGGGTCGAGGCCAGTCTCGAAGCGTGGCTGGGGCTTAGGGGTTGCTCGCTTCATCAGGTGCTGGAGGCGCTGAACTTCGACTGTCGAGAGGAGCTTCA
CTGGGAGCATTCGATCTATCGCCACGACAGCTTCGTTCGGGGGGACCCTGGCAAGATCACGGAGATGCTAGTCAATGATGCGCCGTTCCTCGGCAGCGAG
AAGGGTATGGCCATGCCCAGTGTCGCCTACAGCGCGGCGTTAAAGCCGCTGGAAGTTCGACTGAGTCTTCCCGAGTCGAACTCGCAGACTTGGGAGGTCA
CCGTCGCACCGAGCGTCCTGCCCCACCCAGGCATCGACGACAAAGGGGGTTTCCACTTTCAGGACTGTCTCGGTGTTGATAGCAGCATGGAAGAGAGCTC
CTTGGAAGAAATGTTTGACGACACGGACCGATTCAACAGCGACCACGACATGAAGTCGCCACTGTGGTGGTCTCAGCACAGTGACTTCTCCAGCATTTGC
ACGGATGATCTGTCCGACATGGATGCGCTCTCTCAGATCAGCGTGTTCTACGGATAGTGGGGCACGTATTTTTTTAAGAAACACCACTAACAGCCAGTTG
GCGCAGTAAAATCATNCAGGAGGCGGATTGAGAGAAATTGCGTACACTGGCCAAAGGAGGCAGTAGTGTTGAAGTGAATATGCAGTTTTCCATCTACCTT
ACACAGAGTTTTTGCGCTGGAAACTTGTGGTTGAGTTGTCGGGGTCGGATCTCTCACCGCTCAGGCTTGCCTCCTCGGTCATTGCGCTACCGTGCACTGA
GTTCAGCGGGGCCCACGCCGACGGCGCCACACCGTTAGAGTTTAGTGGCACCGCGCCGTCAGTCATGTCGCTCGAGACGTCAACTTCGTAGAAATCGTAG
ATGGTCTTGACAGTGACCTCCGAGTCCTTGTTGTTGATATCCTTGTGGTACGCCTCCAGGGTGAGCCAGAAGAGCGGCACGATATAGAGCGCAGAGAACA
CATCGATCGTGTAGTGCTTGCGCGAAGCCACGATCAGGAACGCGATCGCAATCTGCACGCACACCATGATGGTGATTCCGTACTTGTTGGGCCAGAACTT
CCAGACCGTGAGGATAAGCGACACCGTGTAGATCGTGTGGGAGCTGAACATCAAGTCGCCGCAACCGTTGAGAGAGTCGAGGCGGGTGAACCACTCGCTC
ACAGTGGGCGGGTTGAAGTCAGGGTTGGGAATAACGCAAGGGACCGGGTCGTCGGGGTTCGCCGCCAAGCACGTGTCGTCAAAATTGAGCTCGCAGTGCG
CGGCTGGGGACGGCAGCGCCGTCACGAGGAACGAAATGCAGCGGAAGACCAGACAGATGCTGAGCTGCAGCAGACAGCGCTTGAGCACGATCACCAGGTA
GCGCGGGCGGCCGGGCTCCTGCTTGAAGAGCGGGATGGTCAGCACCAGGATGATGGCTGGGCCAAAGACAGCGACGAACACGAGGATGTCCGAGAGCGAC
GCCGCGGTGCCGGTCAGCTCGGGCATGAGCTCGTAGCCCAGGTCGTAGAGCGTGAAACGCTGCTCCGTGGACAGGTAGTTGCCCTGGATGTAGTACGCCA
GGTTGTGGAAGATGGCGTGGACGTACTGCATGATGACGCACGGCAAGATGATCTTCCACTCGCGGGCCAACAGCTGCAGCTCGATCTTCACATAGTTGAT
GAAGTTCTGCTTGTCACGGAGCTGCCAGCGCCTCATAGTGTCGAGTGTTCTGTTTTGGGAGGAGACGGGAGGTAGCGACCGCGGAGGCTTCGCTTCGGAT
CAGACGGAACTGTGCACGGAGACAGGAGGATGGAGGCCAGGTGAGCTATTTTTTCGAGCTATGGACGCGGATTTCGACAGCGACCACGTACGTACCAATG
TTTTCCGCTGCGTGCTGCCGCTCTGATTATCGAGTGGAGATCTGGAGCTCGAGTCGCTCGCCCTCCTCTTCCGCGCGCTGAACGTCCGCGGTCGGCCTGA
TGTTTGGTTGTGAGAAGTGGCCAAAAACGGAACCAGCGCCCGCGATTGCGCCTTGGTATTATGGCGAGGAAACTGTTATATAGAATGCCGGTACTAATTC
GTGCGGTAATGATAGCCGCCTCAAACAAGCAGTTTCACCTCTCTGTGACCTGTCTTGCCACTATATCCCATCTAAGATATTTCTTTGTAGCCATACCGAA
TTATACGGGGATTACGCGTTCGTGATCATTTGGAGTTTTTTGTCGCAGCGACCGTCGACGATTTGCGTCGAGCGCCATGCTCGAAGTCGATCCGATGGAT
ACCAGGTCCTGCACTGGCAGCAGCAATGCTATCCTACCGCTGTCGTGTCGCTGGTTGAGAATGTCTTCATGCACACCGAGCGCCGCGGTCGAAACGTCTG
CGTCCTAATGATAAACCCGTCGGTTTCGGCAGCGCAGAGCGCTTTCCAACTGGATTTTCCATCGCTGCGTAGGACTCCCGAGGAGCATGAAGCGACGGAG
CAGTTCGGTGCGAGACGATGGCGGCGCGGAGCAAGAGCGGGGCGCGCACCTTCAACTCGCACAGCGCCACCGCAAGATCGTCGCCGGGAGCTTCAAGGGC
CACTCCGCGCTGGAGCCCGAGTTCGCCACGCCCGGCGTGGTCGGCAAGTTCGCGCTGCGCTTTACGACCACCGGACCGCTGGCGAAGCACGCACGAATCA
CCTGCCAATTGCCGGACCACGGCTGGACGCTACCCACTGCGTCGCCGCCGACTGTCGTGCTGCAACTGCCGTCCCCGAATGAGCAGGCGACTACCGCCGC
GCTGCCGCTGGTGAAGATGAACTGGAGTGCTGCGACTAGAACGATGGAGTTTACGCTGCTGAACGAGAGCGTGATCCCCGCGGACACGCCCTTGGTTCTG
GTGGTGTCGGGCGTGGGGACCCCGGAGAAGGCGACGCCGCAGAGCGAAGCTGTCGTCACGACCTTCGAGAAACTCGTGGCGAGAAGCACCGTTCCGGCTT
CCACACGCGGTGGACAGATCGTTGATGGGCCTGCTGCCTTTGCAATTCCGAAAATCGTGCCGGGGTCGATTGGTGGGGCGAAGCGCTGGAGCCCGTCCAA
TTGCTGTCCGGGGGTAGTCTCCGACGTGACGCTGGCGTTTACTGTCAATGGCAAGGTTCCTGCGGGCGGGAAGCTGCTCGTGGAGCTGCCACCTGACGGC
TGGGATATGGACGGCCAGCCCAAGGTGCTGCTTCGTACGCCAGTGTATCACAACAAGGTCCTCACCGCTTCCTGGGATTGCAATCAGCACACCCTAGAGA
TTTACCTAGGCAATGATGGGGCGTCTATTGCTACCAAGACAAATGTGATCCTGACGGTCGCACAGGTGAAGAATCCAAAGAAAGAGACTATGATTTTGTC
CGTGTCAAGTGCATCGAGTGAGACGCGAGCTGCTGCTCGACTTACCACGCTGTCAGCGAGTGGTGGCGTGATTGATGGCCCCAACAAAGTGGACGTGGCG
CGAATTAGTGAGCTCCGAGAACGGGACTTTGAGGTCCTCACAAAAGTGCTTGACGCCGATGCAGCAGAAAACACTGAGGATGGCATTTCCATTGCCAGAG
TTCCAGCTGTCTTGCGCCGAGCAGGTTTGACGCTCTCGGACGAGCTGTTTCAGTCGCTTGTGGCTCCTTGTTTTCCAGTGCGAGAGGACCCTCCCAGAGG
TGAATCGGAAAACAACGAAACGTCGCTGGTTAATACACCACTCGCTGCTACAGTAACACCGACCACACCGGCAGACGATTATCTCTCCAGAGAAGAGTTA
CTCAATGTGTTCGCTCTGGTCTACGCCCCGGCGTACAAATACGGCCAGGAGCTCCGTCTAGCATGTGGTCGAGGACATGTGAATCTCGTACGAGAGTGGA
TAAGTCGCGGCTGCAACCCAAATGCTGGGGACGCTTCAGGTTGGTCATCGTTGCACTACGCCGCCGACTTCGGCCAACTCGAGGTGATCAATCTGCTCGT
CGAGATGTCTACGCCACCTCCAGAGAACGAGTCCATTGGCGAAAACAAATTTTGCACGCTGGAGATCAATGCCCGCGATGGCCACGACTGGACCCCACTC
ATGTGTGCGGCAGCGAATGGCCACGTCGACGTCGTCCAGAGGCTGCTGGCGCTTGGCGCGAGCGTTACACAGACCAGTGCTGAGCACCGCTCGGCTCTGC
ACTGGGCAGCAAGTCGTGGATTGGCCGCAGTAGTCTCCGCTCTGCTTGCCGCTGGCGCAGACGTGCACCAAGCGGATCGATGCGGCTGGACGCCCCTGCA
CTGCGCGACACTGCACGGCAACACGAGCTGTGCGGCGCTTCTCGTCGAGAAAGGCGCCGATTCGTCGGCTCGAGATAAACTCGAGTACACACCCACTTTC
TTCGGCGATGCCACCTTCCTCCTTGCGCCGGCAGGCCCGTAGCAGCAATAACTGTACCAAATCCACGCGACCTTTGTCTCGTCCGAGTCCAAGCAACTGC
AGCTTCAAGTCAATGCACTCGAGTTCGCCAGTGCAATCTAACTGTGACGCCCTCCACCTCCTGCAGCACCTGGTGGAGCGTAGGGGACTCCTTGCATTTC
TTGCATTTCTTGCATCCGAGGATATAGACAACTTTCGTACTTACTCGAAGACCGCCGTTGCGCAAGCACCAACTTGATCCACTAAAGCCCAGGAGCTCCT
CACGCTCATTTTCCCAGTCTCGGAGCCATGGCCACATCTGCAGGAGCCAAAGTGCTGGCTGAGGTGTACCGCCTGCACCACATCCCGCTGCCGCCTATTA
CGCTGCAGGCGCTACTCAAGCGAGGGCCCCGTGCCAGCCCCGCCATCACTGCGTCGCTGCAGAACGATCCGCAGGCGCTGTCCAAGTGGCGCGAGGTGAA
CGCGCCCGCCATCGTCACATCCGCGCAGCTGCTGCATCGCGAGGCACCCATCCGCATCGCGCGCCGCATCGTGGACCTCGAGAACCTGCCGGACGAGCTG
CCAGGCGCGCAGCCCATCGTGTCTCTGCGCGAGCAGCTGCTCAACAGCTTCGAGCAGCTCACGAGCTGCCCGCTGCCGGCTAACCTCGCGGGCGAGAGGG
ACTTCGTGGAGCTGCACCTCAAGATCCGCAAGGAGCACGCCACTATGCACGGCAACATCGCCGAGGCCGTACAGGCGCTCGAGTACGAGCCGCAGGGACT
CAGCGAGTCGCTCGACAACTTTTACAACTCACGCATTGGCATCCGCATGCTCGTGGACCAGCACGTTGCCGCGCAGAGCCCGACGCCGGGCTTCACGGGC
ATTGTCAGCGACGAGTGTTCGCCCGTGCAGATCGCGCAGGACATTGTGCACAAGGTGCGGCCGCTGTGGCAGGAGAGCCTCCACGGTGACCAACTGCCTG
CAATCGTTGTGAATGGGGAGGTGGATGCTACCTACCGCTATATCCCGCAGCACATTGAGATCATCTTGACCGAGGTGTTCAAGAACGCGGTGATTAACAG
TGTCGCTGCGACCAAGAGGACGGGAACCACCACCCCGCCGCCTGTCACGGTGCTGATTTCGGGTGGGCCGCACGGCGTGTGCGTCAAGGTGTCGGACCTT
GGCGGCGGCATGACTCGCAAGGAAGCCAATGCGTTGTCGAACTACTACCACACTGCGACGTCGCCGCCCTCGAGCGGATACGACCCCGTTGCGGATGTGT
TGGAGAGGCGTGCTAGCGGACTGGACTTCTCAGACTCGTTCGGTCTGCGCATTGCTCAGCTCTACGCCAAATACTTTGGCGGCGAGTTGGCGATCATGCC
TATGGAAGGTCACGGTGTGGACACGTATATTTACATGAACTGCCTCACCGGCGCCTCTGAGCTCAAGTAAGAAAAGT