Description :
From Genome Similarity Track
Location :
Scaffold_912:7769- 12360
Transcript NameFunction/comments
g11115.t1hypothetical protein
g11116.t1hypothetical protein

Sequence
4591 bases(100 bases per row)
GAGGTTCTACCACTTGGTCCTACTGATGGTTGCCGTGCTGTTTGCAAGTGCTGACCCCACCTCGGCGTATCGGGGATCGAAGCTGACGACACCTGGCGCG
CAGACTCAAGTGCTTCAAGACAACACCGCCACCAAGAGGCTGCTGAGAGCTTACACCGACGACGAAAAGAGGGGCATTTCAATCCCCGGTTTAGAGAGCG
TCTTAAAAGTGTTTCCGTCAAGCAAGACCAAGCAGCTCCAGGGACTGCTCAAGGCCGACGAGACTCTCGGCAATGCCTTCAAGACGTTGGGGCTCAGCAA
AATGCCTATTGCTAAGAATAATTTTATCGAGACGAAAATGGTGGAGAAACTTTTTTCGAGCACCAACTTCAAGGTTTGGTCCAAGCATGCCGCCCGGTTG
AACAAGCAAGACCCCGAAGGTGCAATGCTTACCTCACTCACGAACGTCTTTGGCGAGAAAAATGTGGCGACAATGATTTTGTTGGGGAAGCGTTCGCGGA
GGTCACACCAGGTCGCCAAGAAGTTGGAAGCTGCGAAGATCAAGAAGTGGTTCTCCATGGACAAGTTGACAGCTGATGACGTGTTAGGTCGGAAGAAATA
TATGTGGGGTCAAGCCGTGTAACTACGATACGTACTTACATAACTCATGCCGTGCTTTGGCCGGGAAGCTTTGGATACTTAGGACCAATGCTGCATACAT
GTATTGTGTATTGCAGTCTTTTTGGCACTGTTGACTCTAATTCGTACGACTTGTGCTGTGGAACCTAATGACCCATATCTACGAGAAGATCGACCGACGC
TAACGCGTGCTGTTCTCCCATGCCATCCCGATGAAGAAGAAGTGCGCGACGTCGTCCACCAGTTTCGTGGCGCTAGTTCCTGATCCATGAGGTTGCACGA
ATGTACATGTCCGACTGGGTCAACATTCACAATTTGGGATAAGATATCATAGCTCGTCAAATATTTCGTCGTTTTAGCTTGCGCTCACCTTTAGCGTTAT
TACAAAACTACACAAATATGATTTGATACAGGATTTGCGAAGACTTTGGATATGAATATCCAGAGAACATCAAAAAGTTATTATTGCAAAATAGTGACGC
GTATTTATCTGCTAGCGCTTTTCTGGGGTCTTTGATCTAGACGAAGATTGGCTGTTAGTGTGGTGTATCTCAGGTGGCGGTATCGGTCGACATGCGCAAT
ACCCGGTAGCTGCGCCTACTTTTTGGCCCAATTACTTATGTCGAGTACAATACAGATGTCCCCGGCAAATTTGCAAACTGCAGGCAGCAATTTACCTTGT
ACAGGTAGTACAGATGTGCATGGGATTTGGGATGGGATGTACTGAGGTAGATGTAACTTGGAGGGAAAATGTCGCGCTGCGAGAAGCTTCCTGTACGTGG
GTGCAGTAAATAAAGAGTAACTTAGTACTTTTGCATCTATATGGCACCTGTGCGAATCTTGCAAGGCAGTGTGGCGAAGCGATCAGTCAATTTGGCGGTC
ACGGCCGATCAATCATGAAAGGATGGGATTGGGACCTGAGATGGGTGGATCTGGCCGTGGGACAATAAGTCCGAAAATTCGGATGACCATCACTTTCACA
TGGGACCATCACTCTGCATCGGATGATTGACATGGGTGCACGCGATCACACAGGACATGGCTACACAATAGATGATCGACATGGGTACAGGCGATCACTC
GGACGATCGCCGAGGAGATGGGTACGGATCGGCTGATCATTTGGGGAGGTACCACTGAAAGGGTACACAGGAGGTATAGGATGGGTTGTGGATCGTAGGA
TAGGAATCAGGATGGGGGGCGGGTACATAGTTTTTAAGGGATAAACAGACCAGAATTTTCCTTGCAAGACACAAGTGGCCAGCGGAATTCCGTATATTGG
CCTACCCGACGACCCGACAACCCACATAGTGAAATCAAGTGTAAACGTGGAAGCCCCTAGATCGCTTGGCTAGGCGCGCTCTCCCTTCTGTCTCAACTCA
TCAAGACCCCGCCATAGGAGGCGGCAAGCAATGTAAAGGACCCCGCAAAGGAAAACAACCCCCCGTGATCGATCCCACACGCGATCGACATCTGATACCG
ACCGACTGCGTGAAGCATATCCGCGTAGTTGTCACCTCCCCAACCCCCCATCCCCTGAAGAGCCCATCAAGCTCAAACCCCGATCTCGATCACCACTGAT
ACTCCTCGCGTGAGTGCCGGAAGAGTGCAACCCGCCCAAGCCGTCGGGTACACAAGGTGAGCTACAAGGTCAAGATCCACCGGATCAACGGAGTACCCCT
CCGACAGTCGGCAGTCCGGGCAACCGTTGGCGAGTGCCGGTCACATCAGCAAATTTGTGATCCCGCTCCGCCAGAGCAGTACATTGAAAACATTATGAAC
CTGTGAATTTCACAATGATGTGTGAACAGCACAAGCAATCAACAATTTGCACACTGCCGTCTTACCCCGCACACTGCGCCTAGGCGCTCTATTCGAATAT
TCGAGTTTCGAGATCAGAAGATAGAGTTCGGATTATAGCGCTAAGTGAATATAACACTTCGGCACTATTCATCTAAGTTTGATTCTGTGGTAGATGGCAT
ACGGCAGTGCTTGGACCTCGGCATGCAATCGAGGTTAAAATACCCACGCTGTTGACACCCATCAAACCAAAGCGGTCTGCTCCGCTGCTATAGCTCTCAT
TTTCAATTCTACAGTGATGACCGAAGCAAAACCCAAGATGAAACGCCGTAGCTACACCATCAAGGACAAACTCGCCATCACTGCTGAGTACGAAGAGGGT
ATCATCGACAGTGGCTTCACGTCCTCGGTATCAAGCACAATGTCGCCTCTGGAACGCTGCGAGGATGGTGGAACAATCACCAAAAGCTACTGGAGGCCTC
CAAGAATCGACAGGTCCCAACACGATCGGTGCGGCGTTTAGTAGGTGGAGCCCGTGGCCCTCAGTACAGTAAAGTGGAGGAGTGACTCCATAAATGGGTA
CTCGAAAGATATGCCAAGGGGCTACGGGTGAAGGACAGCTACATACGACTACAAGCTCAAGATATTTACCGCAAGCTGCGCGGCCCCGACGCGTCGACGA
GGTGACTGGCACGCTTCAAGAAAAGGAAGCAGCTCGTATCACGATGCTAGACGACCACCCGTACGCTTCCTGAAGATGCCGCAAAGACCTACAGCCTCTT
TATCCAGTGCGTTCAGCAACGTATTGCCGCGCACAACATCCAACCAAGGAATATTATCAACATGGATCAATTGCCCCGCTACTTTGAGACGAAACTCAAG
TCCACGAGAGGTTCGCGTGAGGTGTCGCTACGGAAGAGCAGAACAAACCACAATAGGTTTACGGCTACCTTCTCTATCATCACCGCTGGTACGATGCTCA
CTCCGCACCTTCTCTTCTCGAAGTTGAAGAACAAGTTCACTGTGCCAGCAAGTGTCACGCCGACGTGAATTGCACGGGCATGTGGAGTGACGAGGTATTG
CTGGACCATACCAAGCAGGTCGTGCGCGGCCGCAAGGAAACTCAGCTTTACTGCGAGCTGGTGCTTTATCTGAGCGACTCATATGGGTGCCTCGTGAAGC
TGATGCAGTCACGTAAACTGGAGCGATACAACATCTTTGTGGTGATCATCCCACCCAATATCACCAACATCTTACAGCCGCTGGACGTTGCAGTCAATCG
CAGCTTCTAGGCGTACTATAGGAACAAATACGACGAGTACATCGGCAGCGTTCTCCAGGATACAGCGCTGCAGACGAGGTGGAAATCCCAAGGCCCCTAG
CTACAGTGTTGTTGGGCAGTGGACTGTCGATTGGATGACGACGCGCACTCTAGACGACATCAACAAAGCGTTTCAACCGTGCGGCTTAGTGCCGAAAGAG
ATAATCGAGGAGAAGAAGCTGCACTGACCTCTCCAGAAAATCCTTGCCCGGACTTTGACTCGGTACGCTGGAACGCGTCCTACCCGTATATACTGGAACA
GTCGGATGACCATGTAGCAGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAATGGATACATTCAGGTTGACCACTCCACAGGGTGG
TCCACATTCATAGAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCAGCCATCCAATGGCA
GAACCTCTCATTAGAAATATCAGTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTTTCGTTCGGTTCCTTTATCTAGG
TTTAAGTATACTTGCGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCATACACGTGCGCACACGTGTAATGTGGTGTTGTGATTCA
CAAAAACTTCGTTAGTGCGGCTTCCACGCAACACCACAACAATTCGCCGAGTCAGGTCGGCGTTGTTGGGCTTGCGCAGGGTTCTGTTGGTTCCCTTTGC
GGTTCGGCCCAGCCGGGTCCAGTTGAGGCTCTGCTCTCGCTGAGTACCAATCCAAACTCCAGAAGCTCGCCTGAGCGGGGCAGCTTCCGTT