Description :
From Genome Similarity Track
Location :
Scaffold_66:7769- 9261
Sequence
1492 bases(100 bases per row)
GAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGCGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGAGACGGAGTAT
GCGGACGTGGTGAACAAACACCCACCGACCCAGGTCCCACCTGATCGAGGCGTACGGCACGAGATTAATCTCGCGCCCGGCACAAAGTATTGTGTCACGA
GGCAATGGCCCCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAATCGAAATCCCCGCACTC
GACGCCGACTTTCTGCGTTCGTAAACCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCTGGCCCAAACACCAATC
CCACGAAAGGATGTGTTGCTGAACAACATGGCCTGTACAGTGCGCTAGATTTTGTAGACGGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCT
CACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGACGCAGGGCTTGTCTAACGCCCCGGCGACATTCAATCGCCTAGTGACGCAT
TTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCCACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAG
GACACCTTCGTCGAGTGTTGGACGTAATGCGAGCGAACAAACTATACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTG
CTTCGCAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGACCCCAGAAGGATCTTCGAAAGTGGTTG
GGCTTGGCCAACTACCTTCATAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGA
GCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCTCTGTCCTGGCCCTGCCGGACGAGACGAAGTCGTTTAGCGTCGTCTGCGATGCC
TCCGATTACGCTATCGGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGA
ACTACCCCGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCTGTAACGGGCCTAGAGTGTCCGTTACTAGCTTACACGTAATAAT
GAGGAAGCGTGCAAGCTCCGCGATAGTGAAACCAAGTACTTAGTCTGAAGGAAATCAACTCTGGTTTTTATTTAGGTCCAGGGCAGCTTGCCCTGACCAC
TCAAATACACGTCAATCCTTATTAGTTGATTATGGGTCTGGCTCCCCATATTTCAACCAATAAGGTGACGGCAGTTCAGCACACGCTACTCG