Description :
From Genome Similarity Track
Location :
Scaffold_1265:7768- 9697
Transcript NameFunction/comments
Phyta_totarag12560hypothetical protein

Sequence
1929 bases(100 bases per row)
AAACCGAGGACCCCAGCGCCCCCATAAGATCCGGGGTTGGGTGGATTTGAAACTGAGGCTGCGGTGGATGGCACGCAAACCCGTGATCGTGATCTTGTGT
TTTCTTGCTGATGGTCGATCGTGTCGCCGCTTGCCGACGATTGCGAGTTTATATCCTGGGAGAAATCCAACGGTAAAACCGAGCTTGTACTGATAAGTGC
ACGGTATATGACTGATCTTGGAGAGGATTATTGACGCTGAATTGCCCTGCCCTGGTCGTCTGATGCGGTATCGCCAGCAGAAAACTGCAAAAAGCACGAG
TTGATTGGAGTGCTGGGCTCGGTAGCTGGTTAACCACGGGGCGAAGTGCATAAATGTGCACCATTCGATTCATTGCTGCCATGTGCCGGCatatttgctg
ctgacgacgatgcaAATGCTGCATATTGCAGTTTAATGAGAACGTCTTAAAAGTGATTGAATGGTTCTCCacgagggggggggggggggggggggggggg
ggcaacgTACAGAAAGGTTCGACAAAGTGACGCATGTGGTTTGCACCAGGCTCTGGAAGCTGCATCTGCTATTTGATTTGTCGCCCCGAGGAGGTGTGTC
GCCGACATTCTAATTTTGAATATGGCCTCTCCGAGCCCGATTGCACGCTTTATTTCTTGAGTTTCTTCGAACGAGATTGCTAGCCGATTTGTCCATGACA
CCGCGGTTCTATTATCACTCCAGCAGCGAATGCGACGTACCATCGATGAAGGCGGCTGCGTCCACtatcccccccccccacgtCCAAATTGCAAGCGCAA
TGCATAGGCGCTCCTTCACATTAATAGAGAACGATCCTGACTTGACAGTCGCGAGTTCATCGTCGCCAAAGCGTACATGAACGAATTCGTCGCGCGCAGG
GTTCAGCACCTCGAGATCCAAGTCAGAAGCGGTCATGTAGACGTGATAATTTGATTCAGGTAACTAACCGAACAGGCACAGTGATAACTCGGAAAGCTGA
CCGTGCCGTCATACTCGAACCAGCGTAAGTCCGATATTACTGTTGCTGGTAGAAATGTTTGACCAAAGCGAGGCTGTCGCATGGTCGCCGCGTGTAAATA
CTTGGAAAAGGTTTTGCTGTCCGAATGCATATCGTGATATACCTCATACTGACTAGCGCTTTGTGAAGCTCGTTGCGTGTGGCCGCTCCTTAGCTAGTAG
GTTGCTGACACGACTAATGCCTTTGTTGATTTTATACTACAGAATCGACAGCGCTCGTGCGTTGGAGTCCTACGTCAGTCCGAGTGCCGTGAGTCGGTTT
CTCACGATGAAATTTGGCTTCGTAGATGGAGCGCGGACCTAGGATCGCTAGCATCGGATGGCGAGTGGTTGCTTCGGCTACGTGAAGCCTGCCACCAACG
TCGATTGCGATCATGATGTGACCATCTACCCACCCGTTCTTCGGGTACGAGTGGGTTGATGAATGCATCATGCTATCAGACTCCAGATCGCTGGAGTCTG
ATACTGTGGCTGGTGAGTTGATAGCCACAAGGCAAGAGATTGGTCGTCCAAAGGCACTGTAAAATTGAGGCAAGCCAGACCAGTCAAACGAGGCTGCGAA
GTCCATGCCTAGAGCGTTCAATTCCTTTACCAGGCCAGCTATCTGATGCACGTGATCAGCGGAGGTCATCAGATGTCGATAAGCGCCTTTGACGTCGTCT
TTTAGGATTCTCATGGTACACTTTGGGTGTGTTGTCGCCAGGAAATTGATCCATGCGGCGAGCACCATCACGTACACATAGTGGACTTCAGACGAGCAGG
TTTTGTCGAGAAGATCATTCGTAGACGCTCCGGCAGGAAATGGCAGTTTATGAATTAGTCTAATTTCGATGAGAGGGACGTCACGTTTTTCAACGGCACT
GAAGGGACTGCAACGCACATATTTCCACT