Description :
From Genome Similarity Track
Location :
scaffold_1059:7768- 8955
Transcript NameFunction/comments
Pl_101424conserved hypothetical protein

Sequence
1187 bases(100 bases per row)
CAACGATGTCAATCTTACACAGTAATGCGGTTTACGCGCTCGGTTTTCTTGGCCTCTTCGATGATGCGGATCTGCTTAATCACCTCTTCCGGGTCGACCA
GCAGCTTCTCCTCACCACGGATAGCAGCCGCAATGTTCTTGTAGTACACCTCGTACGATCCCAACTTGCTGGGGACGACGCGAGTCTCACCTGTAGCTGC
GTCCGTGAATTTGCCGAACGAGCTTTCAGGCTCTTGACCCCAGCCATCATCACCAGGACGCTTGCCAGCACGTAGAGCGTCCTCTTGCCCATCCTCGCCG
TACTTGATGAACGTTCCCTTGGTGCCCACAACAGTGTACTTGGGACCGGGGTTCTTGACGAGCATACCAGCGCTCAGAATCACCTCTCTCTCCGGGAACT
TCTTGTATTTGAACTCGAGACGGAAGTAGTCGTCGTTCTCGGCTCCTTCACGTTGAATCTGCACGTCCGCATCGACTGAGTCGGGCTTGCCAAAAAGCTG
CAGAGCTTGATCCGTGACGTGAGCTCCTAGGTCATACAACACACCTCCGCAGAGACCAGCCTTCTCCTTCCAGTAGTCCTTCATGTTAGGACGGTAGCGG
TCATAGTGAGCCTCAAACTTCTGTACTTCTCCGACTGTGCCGTCCTCAATCAAACTCCTTAGTGTGAGGAAGTCGCTGTCGAAGCGGCGGTTGTGGAAGA
CGGAGAAGAGCACGCCGTTGGCTTTAGCAATAGCACAAAGATCCTCGGCCTGTTGCGCCGTGACGCACAGCGGTTTGTCCACGACCACGTGGCGCTTGGC
CTCCATAGCCTGCTTAGCCTGCTCAAAGTGCACCGTTGTAGGTGTCGAGATGACCACGAGCTGCACGTCCGTGGCCAACAGTTCGTCCATGGAGCGCACG
ATCTTGGGAGCAGGTGACAGCGCTTGGCTCTTGCTAGTCGAGCGCTCCAACACGTGCGTGAGTTCGAACTGACCCGAACTCATGAGCAGCGGCGCGTGGA
ACACACTGGAGCCTGTGCCGAAGCCCACGAGACCGACGGGGATCTTGGTGGTCATTGTCTTGGAAGGGGGATGGGCAATGCTGCTTGGTGTGCAAATTCT
GAAGTGAGCTCCTGACTGCGAGTCTCAATTGCAGGGACCATGTGGATGGTGAACGTCAGCTGAGAGGAAACGTTAAAATCACAACTT