Description :
From Genome Similarity Track
Location :
scaffold_12:77667- 78752
Transcript NameFunction/comments
Plaha_PHALS_13203Zinc finger%2C C2H2

Sequence
1085 bases(100 bases per row)
ATGACGATCTTTACGAATATACTCTCATCACCGAGAAAATGGCTGTAGGGTTGTCGGCCTCAAGGACGGCCCCTTTCTCCGAGGCTCGCCAATTCATATG
ATAGGAGTAAATGTCGTCGCAAAGACTTTGTTAGAAGCAGGCAGTAGGAAGAAGGAAATTCAGTGCTCGTTAAGTATTTATTTCAACGCAATCTCTTGAG
ACGACACACTTCTTGAGCTTCGATGTGGCCCACTGGTGGTTGAAATGGAGTACGTACTGTACTATCGCATCCATACACTTTCGTGCCATTGCATATCATA
CttttgtgcatttgtctCGTTCCTTTCGTTGTTCAATTTACTACTGCAAACATTCCTGGAACGTTCTTATGACCAAAAAACTCGTTGAGGAGATAAATTT
GCCGACATTTGATTGACCCTTAAAAACGAGTACTATCATGCATCGCCGCAGCTATTAATATCAGGCTTAAATGGcaatttcatcaaaaaaaattcaggAA
ATGAAGAAAAAGTTGTTATTACAAAATCAGCTCGAATGGTTCTTCGCCTACCACAATATAATGATATTCTTCACAAGCTTATCCTATCAACACGAGCGAC
GCCATGCCATCCTTAGTAAGCATGTCGTACTCAAACTTAAATATTAAATCCATAGCTCCTTACTATGTCCCTGAAGCGCAACGCGAGCATGAGCCGCCAT
CTCGTCGCGTGCCGCAGCGTATGCAAAATGTTCCTGGGACTGACACACGATGTAAGATCTCTCCGTGGGTATCGCGAATATGAGCGATAAGATCGCTGCG
TGCTCGAAACAAACGACTGCAAAATGTGCAATTCTCCCAaatctcatcatctgcactaGAAAGGCGACTGCTAGTCGACGCATCATGTTCCCCAGACGAC
CCCGAGCCTGACGGTGGGGGGGATGTCACTCGTGCCAACGGAATGTCGCTCACTATGTCCGCTTCGTCCTCACCGATAAATAGCATTTCAGTAGCCGTTA
TAAACGGTGTGGGCTGTCGATATCTGGGGGCGACGGACCCTCGGTCATCTCGTACTGAACGCTGCACTGCTCTGAATCGAATTGG