Description :
From Genome Similarity Track
Location :
Scaffold_152:77654- 78976
Transcript NameFunction/comments
Physo_124246hypothetical protein

Sequence
1322 bases(100 bases per row)
TTGAGTACCGAGCACTAGTCGAGAATGGTACATGGGAACTTGTAAAATTACCCAAAGGGCGGAAATTGTTAGGATGTCACTAGGTATTTGACATAAAATA
CAACGCTGATGGGGCTGTCGACAGGTTTAAGGCCCGACTGGTAGTAAGAGGAAATACACAAATTCACGGTATAGACTACAATGAGATTTTTCCGCGGTCG
CGAGGTATGAGTCGTTGCGCTTGCTACTCGCTATAACAACTATTAACGATTTACATGTTCACCAAATGGATGTGGCCACAGCGTTCCTCAACGGAACGTT
GTTTGAGGATATTTATATGCAACAATCTCACGGGTTTCGGCATGGGGATGGCTCGACCGTGTGTAAGCTAAAGAAGAGTCTATACGGACTCAAACAGGCT
CCGCGAATTTGGTATGCGCTCATCAACAAGTTCTTGGCGCAACTAGGGTTTTCCCGGTGCAAAAAGGAGTTCTGTTTGTACCGGCAAAAGTGGGAGGTAA
ATGGAGAGTCGCACATAGTACTAATCGGTGTGTACGTGGACGGCATTACTATTGCCGCGAGTATTATGATACTCATGGAAAAAGTTAAGGCAAAACTTGC
GTCACAGTTTACTATGTAGGACTTAGGCGAGGTTCACTGCATCCTCAAAATGGAAGTTAAGCGAGACAGGGCTAACCAGATCCTTAGTATGTCCCAACAT
AAGTATATCATGAACTTACTACAAAAGTTTGATATGACTAAGTGTGTCCCAGAGCCAACACCTCAGGCCAAAAGTGTAGTACTAGAAAAGGAAGAATATG
AGTCCTGAGCAAATAGCAGCTCCGCCATTCGATTACAGAGGTTTAGTGGGGTCTTTGATGTATCTTGTTCGTGGAACATACCTGATATAGCAAATGCTGT
CATAGAGCTAAGTAAGTTCCTCTCATGCTATAATAAGAGCCATTACAGGGCAGCCCAGAGAGTACTAAAATATCTGAAAGGAACGTCGAAGTATGGGCTT
GTATTCGATGGAAAGTTTAAGGAAGTAATATACGAGATATACACAGACCCGAGCTGCGCGAATGCAAATGAGAACCGAAAGTCAGCTACTGGGTATGTCA
GTATTATGGCAGATGTGTGTATTACTTGAAACAGTTCGAGGCAAGATACTGTAAGTCTCCACATAGCACAGAGGGAGTCAAAGAGAGCGAATGGTTGTGG
TTTCTATTGGAGGGGCTGGGCTTTAAGCAGAAGCAACCGATAGTATGCTGGTGTGATAATAAAGGAGCCATTACTATAATAAAGGATCCAGCTAATTATG
CTCCAACAAAGCACACTGATAT