Description :
From Genome Similarity Track
Location :
Scaffold_789:7765- 11395
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_789-snap-gene-0.3Fumarylacetoacetate (FAA) hydrolase
Pytiw_DAOMBR242034maker-piw_contig_789-snap-gene-0.5Conserved gene of unknown function

Sequence
3630 bases(100 bases per row)
GCTCTCTCTCTCTGTGGATGTGTCTACAGCAAGAAGATCGTCGCGATCGGCAAGAATTACGAGGCCCACGCGCGCGAAATGGGTGCCGCGAGCGCCCCCA
AGGACCCCGTGATCTTCCTCAAGCCTACCACCAGGTAGATACATCCACATATGGCAGTATGCAGTGGTTGACTAATGGCTGGGGATGTAAATGAATGAGC
AGCTACGTGACGAATGGCGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNGCACCACGAGGTGGAGCTGGGCGTGAGTGGCGATGTGCTGTTATCGGATGTGTATAGCGATGTTTATAGTGAT
GTGCGTATACTAAATCTGTTGTCTATAGGTCGTGATTGGCAAGGGCGGGCGCGACATCGCCGAGAAGGACAGCATGGACCACGTGTCCGGATACGTAAGC
CCATTGGCATCACTTGCAGTGTATAGTTTGGTATACACATGTTCAAACCTGAGTCGATGTGTCTACGTAGGTCCTAGCGATCGACATGACGGCGCGCCAC
CTGCAGGACAAGGCGAAGAAGGCGGGTCTGCCGTGGACGCAGGCCAAGGGCTTCGACACCTTCACGCCCGTGAGCGACTTCATCCCCAAGGAGTTCGTAC
CAAACCCACACGACCTCTCGATATGGCTCAGGGTACGACTCTCTGTATCCCTACTGTGTATACCTCCATGGCTAACTTTATCGTGTCTCTTGCTCAGGTC
GACGACGAGCTCCGCCAGGATGGCAACACGGCGGACATGGTGCACAAGATCCCGTTCCTAATCGCCCATGTGAGCCGCATCATGACGCTCGAGGAGGGCG
ACGTGATCATCACGGGCACCCCCGAGGGCGTGGGGCCAGTACCACCAAACTCGGTCATGACGGCCGGCATCGACGGCATCGTCAGCGTGCGCTTCCCAGT
CGAGACCCGCAAGTACAAGCTCTAGAGAGCAAGGCTCAGCCTCAGTCAAACCAAGACAGCCCGCGCTCAGTGGGCTCCCATCCATGTCGTTGGAGGGTAA
TAGCTAACATTGTGATTCAGCTACTCATTTTATTCTAAGCTCTCTGTGTTCAGTCCGCCACGAGGCGTTCCATGAGCGACACGAGCGAACTGTCGACGTT
GACCTTGCGCAGGGACGTCATCTTGCGCAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGTACGGCCCACCCGCGGTAGATCGCCTGGATGCGCAGCGCCGCGGCGTCGTGGCG
CAGATTGCGGATCGCCGTGAGCGCGTGAGCGTGAACCCGGGGCGAGGTACTCGAAGCCTTGCAGAACTGGAGCAGTGTGCCCAGCACGCCGCTCTCGACG
ATCTTGTTGCGCGATGCGTGCACCATGGACATGGCGGCGATCGCGCGCGTGGCTTCGTAGAGCACTTCGTTGTTGCGTGAGATGGGGCAGACGTATTTGA
CCAAGATCGCGAGGACGCCTTCGTCCACGAGCTTCAAGATATTCTCCGGCCGCTCGGCGAAGTTCGCGATCGTGCGCGCAATGTTGTACCGCGTCTGGAC
GAGCGGGTGGAATGCGAAGTCCCTGAGCGCGCGCAGCAGCTGCGGTTTGCACATGGTGATACGCGAGTTCTCGTCCTCGGTGAGCTGCGCGATGGCGCCG
ATCGCGTCCACTTTCATGCTGAAGTCGTTGCCGTTGAGGATGCCGAAGAGACACTTGACGACGCCCCTGGCGAGCAGCTCAATGTAGTGCTTGTACTCGG
ACTCGAGCGAGGGCGGCTCCTGCTTGGCGGCCGGCTGTGGCAGCTCGGCGAGCTCGAGCTTGACCGTGTCCGAGTGGATAAGTAGCGAGATCTGATGGAT
GCTGGAGCGCTGGCGGTCGCGCTCGCGCTCCTTGCAGATGAGGAACGTGAGAAGCGTGATCACCGACCGTCGCACGCGCTTGTCCGGCGACGCGTACAGA
TTGCGGCTCGCGATGTAGTCGACAAGCTTGGAGCGGATCACGTGCTCGCGGTTGCTCGGGTTCTTGGCCATCTCGCAGAAGATCACGAACGCCGGCCGCA
GGATCGTGTTGAGTTCACTAGGCACCGAGACGACAGTGTTGGCTGAGGTTGAGGCTGAGGATGCGGGGGCTGTTGCATCAGGCTTTGGCTCGGTTGGGTT
CGTGGTGAGCATGATCCCAGGCCCTTTGGCTCGCTGAGCGATGGCGTCACGCCGACTCGAGCCACTGACCGAGGCCGCAGCTGAGCTCGGACGCCGCCCA
ATGATCCCGTGGTGATGGTGATGAACCCCAAGCTTCCCAGCTCCACCATTTTCCATCGGCAGCCCTCGGTTCGGACAGAAACAGAGCTGGACGATCCGCG
GCAGTGCGTTCGCGTTCACGAGTGCCACGTGGTTCTTCTTGTTGATCGCGAGCGACTCAAGGATCGAGACCACGAGCAGACAGATCTGCAGGTTGGTCTT
GGGAGAGTCGAGGATCAGCAGCAGCGTCGGGATCAGATTCAGTTCGACGAAGCGTCTGCCGTTCTCTTCCTCAGCCACGAGCAGGTGGATAAAGCCCAGC
AGCTCGCGGCGGAACGCAAAGTCCTTCTCCATGTACGGGTCGTGGAGGATCCCGGCCAGCGTCTCGAAGTGCTTGTTCGAGTGGTAGAACAGGAACCGGT
TGTCGCGGCAGGCGGCGAGTTGGTTGAGGATCGCGGCCGCGAGGCACCGTAGGCGCGAGTCCTTGGACGTGCAGGACTCGAGCATGAACGCAAAGCCCTC
GCGCTTGGCAATCACGTCGCGCAGCTCGTCGGTCGTCACGAGGTTGTGCATGATCTCAAAGGCCGTGCGCCGCAGCTTGAGGTCCGCCGAGTGCAGCAGC
GAGAAGACGCAGTCGAGACCGTCGGGCGCCTGCAGGATCTTCAGCTTGACCGACGGCAGCCGAGCCATCATGGCCAGCGCCTGGGCGCAGTCGCGCGCGA
TGCTTGGGTCCAGTCGATCCTGGTACGAGCTCAGCATTGAGATGAGCGCGCCCAGCGTCCCGACTTCGGAGAGGAGCTCCAGGTTGGCAGCTACAGTGGA
GAGAGAGGCAAGAGATCAACTGTAAGCATGTGAGGGAACACACGTGACCACGGGCTACGTACAGTTCCTGCTGAGCGAGGCCAGCGCTGCGGCAGCGTCA
CGCCGCACTTCGAGAAACGGGGACCAGTATGCGATCTCGATGAGCGGCCGCACGTCGTCGGCGTCCACGTCCTGGCACTTCATGGATCGGAGCACGAACG
CGCTCTTGAGCGCATCGCGCTTGCTCTCGC