Description :
From Genome Similarity Track
Location :
Scaffold_9:776392- 778237
Transcript NameFunction/comments
Physo_340066reverse transcriptase

Sequence
1845 bases(100 bases per row)
CAACCACCTTGCAGATCCATCACCACACTTTCTACCCAAAGTGACCAACTCATTCCAGGAGACCGCAGCCCCCGCTACTCCTCGTGGGACTGCATCACAC
CGAACCGGTTCCGGTTAGTGCGGCTCCGCAGAAACTCATGTAGTATAGCGCCACAGTTGAGATCCGCTTCATCCACCCAGGATGGATCTTCATATCCACG
CCAGTGTACCACGAATTCACGGTGAATCCGACCATAACGAGTGCGCTTTCCAGTCCTCATGTCCGTGATTTCTCCACTTCGTACTCGTCCTCTTCTAGAT
CCTGGATCCAGCTATCCTCCGGCAATAGCGCTTCATTAAAATCGTATCGATCTGTGGTACCTTCGGTTAGCTGGATCCGGGGCCGGTCTGGAAACCTTTT
CACCAGCTTAAGCTTGGAGACGTGAACCACAGGAAACAACCGATACTCCGTACCCGGGGACTCGATCCGCACAGCATACTCACCTATCTTCTCGGCCACG
CGAAATGGCCCATCCCACATATGCGCCAGCTTGCGAGTGTACCCTTCCTTAACGCGATCCAGGTACAGCCAGACTCTAGATCCAACTTCGATCTGGTGCG
GATGGATCTCTTCATTATGCCGATACGCCCGATCCGAGATCGCCTCCTGCAGCCGCATATTGACTTCTGCCCGCGCCTGTTGGTAATAGCGTTGGATCTT
GTATTGCCACCGCCGTGGATCCCGATCCTGGCGGCGAGTATTGCCTACCGAGATTGTGGCTTCAAGTGTGGATCTCGGATCCCAGCCATGTACCAAGTAA
AATGGTGTTTCTCCTCGGATCCGATCTTGGGCAGTATTAAGCGCGAAGGTGAGACGCTCCGCGTAATCATCCCAATCGCGCTGATCCAGATGCTGCACAT
ACATCTTCAGAGCGCGAGTTGCTGTTTGCACCATGCGTTCGGCGGTTCCATTCGCTTGCGGCCTGTATGACATCGTCGCACGTTGTCGTTGACCCAGGAT
CCGGTTGAAGGATCGGAAGAAGTCCGCCATGAACCCCGGCTCACGGTCGTGCCGGATCACTTCGCTAGCACCGAATCGTCTGAAACACACACTCTTCGTA
GGACTCCGCGATTGTCTGCGCAGTTATGGAGTCACTGGCCTTCGCGATCACGTATCCCGTAAACAGATCCACCCAGATCAACAACTCGGTATTACCTTTG
TTGGATCTAGGCAGCGACGGTATATGATCCATCGCTATAATCTGGAACGGGTATGTGGCTTGGCTGTTCCCAGGCGACTCTCCTTGGATCGTGGGTCGTC
CTTTGCCCGTTTCGCAATCCACACACTCTCCGACATATCTTTGAACACTCCGATACAAACCTCTCCAGTGAAAGCGATCCCGGATTCGCTGGTAGGTGCG
GCCGATTCCTTGGTGACCCCCTTCCAGGCTGACGTGGTAATGATGGAGCACGTCTTGTTGCAAGGTCTCCGGGAGCACCAGCCTCATCAACCCTCCTTCT
TCTTCGTCGGAGGGCAGTAGAACAGCAAGTCGTTGAGATCCACTTCATAATCCATCGCAATAGCGCTATAGGAGCTAGCCTCCTCTTGTGCTAGTTCCTG
GATATTGCCCACCAGGTACTTCTTTAGGCCGGAGATCCACGCCTCCTCGTCCTGCGCTTGACGGATCCTGGCGATCCTGAGATCCCGCACTACTTCCTCC
TGTAAGACAGTAGGGCTGGATCTGGATCTGGCATGTGGTCGGGTATCACAGGTGATACACGAGCGACGGGAGCATCTTCCTTACTCTTCACAACCAGGAT
CTCATCCAGTCGGTTCAACGTGACCAGATCCTGCAGATCCACCTC