Description :
From Genome Similarity Track
Location :
scaffold_10:7762- 30086
Transcript NameFunction/comments
Pl_112536cytosol aminopeptidase, putative
Pl_112537cleavage induced conserved hypothetical protein
Pl_112538conserved hypothetical protein
Pl_112539conserved hypothetical protein
Pl_112540hypothetical protein PHYSODRAFT_356191
Pl_112541folate-Biopterin Transporter (FBT) family
Pl_112542conserved hypothetical protein
Pl_112543hypothetical protein PHYSODRAFT_362528
Pl_112544conserved hypothetical protein
Pl_112545conserved hypothetical protein
Pl_112546hypothetical protein PHYSODRAFT_533001

Sequence
22324 bases(100 bases per row)
ACTGCGATGACCTAGCCAAGAAGCTGCAGGAAACGGGTGTGGAGTGCCACGAGCGTTGCTGGCGCCTACCGATTCTCCCAGAACACACTGCCGCTCTTAA
GGGTTCGCAGTCGGACTCCCGCAGTACAAGCCGTGGTCGCTACGGTGGTGCCTCCACTGCAGCAGCATTCCTCCAGCAGTTTGTTTACGAGGGTGTTGAG
TGGGCACATCTCGATATTGCGGGGCCGTCCAATTACAGCTCTCCCAAGTCGTACTTCCCCAAGGGTGCCACAGGCTTTGGCGTTCAGCTGCTTTACTCCT
ACCTGAAGGAGCATGAACATCAGAACTAGACAGAGTACGCTGAGTGCAAAGCGTCTCAACTTTTCACATGATACACTTTGTGCGTCATGTTTGTTGATAC
TCAATAGAGATGGCAAAAAAAATATGAAAGGAGTGTTGAGGCTATTGAATCAGGTAAGGATGGCTACTGCTCTGTGTATAGATTCCAGACGAAAATGCAG
CCGTCTTCACCGACCGAGACAAGCTGCCGATCATCCGAGCTGAAAGCCAAACCGCGGACATTGCCAGAGTGCCCTACGCCATCCATGATCAACTGGTTGG
TGTTGTAATCCCAGAGTTTGACGAGTCGATCATTTCCGCCAGTGGCAAATACTTCCAGATTGTGCGCCACAGCGATGCACGTGGCTTCTTCATTATGGGC
CTTCTGGATCACAGTCACAGGTGTGTCAATTCGCAGGTCCCAATACGATATGCGTTTTTCCTGACCAGCACTCAAGACAAGTCGCTGGTCGGCCGATAAC
GCTACAGTATTGATGCCGCCCATGCGCTGGATATGGCTTGAAATTCTGCGTTCGTTGCGTAGATCCCAGCAGAGCAGACTACGATCTCGACTGCAAGAAA
TCACGTGCAGGTCGTCGCGATACAGCGCCAGACTCGTGACTGTCATCGAGTGCTCCTTAAGGTGCGAAACCAAGTCACGTTTGCGAATATCCCACACACG
AACCTCACCGCCAACACCCGCCGACACGATGAAGCGCTGATTGTGACTCAGTACTAGTGCTGTTACCCCACCGGTGTGGGCATTATCAATGGACCAAGCC
AGCTCACCAGAATCGCTGCCATGAGATCGGATACAACCATCAGTCCAACCTGAGATTAACACGTCGAGTGAATACTGGAGAGATGTCGGTGCACCTGCAC
CGCCGACGATGCAGCGAGTCGCAACAGTGTAGTCCGAGGCATCCCATACGCGAATAGTGCAGTCTCGAGAGATGGTGGCGAATCGATCCGACACTTCTGG
GGCGTAGGCTATCTGCACGACACCGTTGGAGTGGTTTTCGGACAGCAATCGAGCCTGCAGACTGCGCTGTGAGGTAAGGCGAACTAAAAAAATACTACCA
GCTTGTGTTCCAGCGACAATTTCATTCTGAGCTGCATTGAGGCCCAATCCGACAACTCCACTGTCCAGTGCAGCGTGACCTGTGTCAATGAAATCGTGTC
CGTAGTGTAGAACACTACCATCACCACCACCCACGAGAATGCCACCATCGTAGTACAACATCGAGTTTACACCGCAAGAGCACGCTGGGATCACCTTGAA
TAGTTGCCGAGTTTTCACACTGACAACACAGAAGTCACCGCTGGAACTACCAGCTACCAGAGACTCGCGGTCAGGAGAAAATTGCACGCAAGTGTAATCG
CGGATGAGTGTCTGCTCAATTTTGTACTGTGTGAGCTCCCCAGTGACAGGATTGAGGACCCAAAGCTGCAGCAACCGGTGCCCAACAGTAGCAAATTGAT
AATTGGTAGTGTCACGACGCTTAACGTCACGCGCCATGCCTCCGAATGCAACCGCAGCGACAATGTTCGACATCTTTTGGTGCGTGGCACAGATATTACC
TGTCATCACGTCCCAAATGTACAGTCGTGGGCCATCCTCCGGTACACCCACAGAGCACAGCAGTCGTTCATCATCTGAGAAAGCAAGCGCAGCGATTCCT
GCATCGTGCTCTGACAATCTGAAAGCCAGTCGTCGCGCTGAATAATCCCACACGAGGACATCTGCACGCCTTCCGCGCTCACCCGTAGCAAGAATTCTTC
CTGAACGGGACATCGCGATGCATGAAACATTTCCCTCATGGCCACGCAGAAAGAGCTGACTATGAGCGTCTTGAAAGGATGTCAGCAATACCGATCCACC
GGCTGGGTACACATAGTCTCGACCTGAAGGATGATAGTGAATGGCATTTGACACTGCTGAGAAGCCGATGGTGTGCTCCAATTCAATTGCGGTGGAGAAC
TGTGATTTATCAATTCGCTGGTGTGGCTCATTTACGGAAGTGCCAGCAGCAAGTCCTCTTGAATTCGGCTTTCCATCCGTGACTGGAGCACTTTCGTAGC
CACGTGCATTATTACCACCATGGCACTGCATTGTGTCGGGACAACGCAGGACTCGAATATTCAGCAATGCGAACGGACTGTAACAATGCCCGATGAAGTA
ACCAACTAAACTAAACATATATCCCAAGTTAGTTAGCTTGCCTACTCCACGACCCCTGATTCCAGAAGTCCCGTGGCACCTACATAGCTCAAGCACGTAT
AGTACGGCGGTAAGTTGTTCTCCTGCATCCACCGAGCCACATCAAGTCCGATGTCCTCCTGTCGATCAAACAAATTCAATCGCAAGACACCCCGAGCGAG
AAATACCCGAGCCGGTAGCTCGAGTGTTTGCACCTAATCAAGCAGCAAATTGCAGTGAGTAAAATGTTACAACCCGTCATTGCAGCACACAATGCACCTT
CATATCCTTAACGACGCTGGAAACCATGGACTCGTAAACCAACGTGTCAATCTCTCCGTCGTCTCCCAGTTCGTACAGTGCAAATGATACCCGCTTCGGG
GAATACGTCGGACTGCCAGGGTACCAGAACACTCTGTAAGGCACGATCTGCACGCTGTTCACCAGACAGTTCTCCTCCAAAGTGTAATCCAGATGATCTG
TCGTCGAATATCCCCACGTTGAGGCGCTACAAGTCCACAACATTAATCACCACTTCAATCATCTTTATCCCCTGTCCTGTTACCTGCTCCAGTAGCACGG
TCGACCTCTTGCACAGCCACACTTCAGCTGTAGCCTCTTAGCAATCGCTTCAAAGGCCAACGGGTCGTTTGCCACCACCGTATTGGATAGCAAAGCCACC
CCAATACCGCAGTGCGACCTCGTCAGCGTGTTTTCAGCCGACTCGTTCGTGTGGTCCACTGACGAGCACTCTGCAGCATTCGGTTAGTACTCAACAAGCG
TTTCTCGCCATCAGAGCATCCATCACCTTTCACTTGACGCAGCATCGATATCTCTTCGCCCACGGGTCTCAGACTCAACAGCATCAGGTGTTTCCACTCG
GCCGAGCTCCGTGTGCGACCACCGCCTGCGTATAACGCCTCGTGCTGCGCTAGCGTCTGCCAAATATCTGAAGAGCGGAATCAGACGAGCACAACGTCTC
TCGCAAAGGGACAAGAACGCACCACACTGGACGATGGTGTCCCGCACATGGCGATTGACAGCTTCGAGGTTCAGGAGACTCCTATGGTCGGCGAAGTGCA
GCGCTGCCGCCAACAAGTCGCTCGGCAGGTCACTGAGCCCCATCGTCACTTCTCGTTACAAAGTTGAACCTGCACTTATTTGTGAAGTAGCTGTGAAGTA
GTGTACAATGTTTGCAGTTACTTCAGGCTGTTTTAATCATGTTGAAGTGAAAATGGACGTACAGGCTCAACATCGGGTTACATGTATTTCCTGCTCTTTT
ACCTATACAGTCGACCACTGCAGTCTAGTCGTCCCAGCGATTCAGAGCCTGACGAAGCATGCGTTGGAACTGCGAGGTGGCAGCCCGTTCCTTCTCGATC
TCGACTCGAAGGCGCTTCATTTCGCCCACTGCCTTGTACTGCTGCATCGACGAGTCAACTGCTCCGAAACTCCGTCGTACGCTCTGCATTGAAACCTGCA
CAGGTTTATTCACGACCACACAATCATGCTTGGTGGATGGATTGGAAGCAACGAGCAGCTTCGGCGTCGAGCTACGCACAGCATCCAGCAGAGTAGAAAC
ACTCGATCCGAAGCCGCACGAATCAGCTGGGTAGTAAATAGTGATATCCCTCAGCGTCTCAAAGAACGTCTCGTAAATCTCTTCGAATATCTTGCGCCAC
GGCAGCAACACATTAGCCTCGGCTGGAGACACCAGCTCGCTTTTTCCGTCGTGGGTCAGGATCTCGTGAACTGGGAGAAGCGCACGGTATATCCGTTTCT
TGAGTTCATACGTCGACACTGACGCTGAAGCTGGATACGCCAAGAAGAGTCTGTCGATGAAGTCCTCCACCTTCTTAAAGTAGACGTCGCAGGTCTGGTC
GCGGCCCACTGACGACGTCTCGACGACGATGCGGGTTCTTTCAAGTACTGTCAGAATCTCTCGAATTTCGTGCTGCCTCTCCTGAGAATTCCACCCACGG
GGAGGATCCACAACAGCAAACTGCAACTCTGGCGGAGGGTATGCGAGGTCCATTATGCCGGACGATAACACGTCTTGACGCACATGCGGAAATACGGAAC
AAATATTCCCCTGGATACTAACTGACGACTCGAACTGGTTCATTAAAGACTTGACACTGCCCTCCAAAAGCTCCTTCAGACCAACGCTTTTAAGATGACG
TACAGGAGGAGACAAAGTCGCGATCTTCTCCAGTGTTTGTGCGAACTGGGCAGGAAGATCGGCACCAGCCACAAGAAGCTCGGTGCCGACATGCGCGACC
TGGGCAGCGAATCGACTTCGCACTCGTTCGATATAACTCTCGAGTTTGCTCATAAGAAGTGCCTGCGACGAACTGATTTCTGCAGAAGCGAATCCCAGTG
CAAGCACAGTCACACGACATCCCGACTTCAGCGGTGATAACAGTTCTCCAACCCGTTGCTCCCATAAGTTGCAGTTACCAGTTTGATGCAGAGCACTCAG
ATCAATGGGAAGCAGAATCGCTGACGCTGCAGCGAGCTTGTGTTGCTGAGCCTCATGTGTGTTCCGCTGCGTAAACGTTGAATCAAGGTATCGACTGCAC
ACAGCAACACCTTGTGACATATCATTGCTCGAGTGAAAAGTTCGATGACAGTCATGCTCAGGTGCAGAGGCATTCTGTGTTCCAGCTCTGACTGCACACC
ACAAACCAAACGAAGCAGCAGATTCATCTAGAAGATCTGCTATCACCAATTTCCAAGCTATTGATGGCGCACCGGGGTTTTGCTGGCGAAGAGGGGCACT
GACCAGTTTTAGCATGTCTTCAGAACACCAAAGAGACAATAGCTCTGTATCTGAAATCGCCGCAACTTCTTCAACTCTCGGTAATTGCTTCAGTCGCTTC
GCACCAATAGGAGTACGATACGCACCGTTGTCTCCCCTAAAAAGCCACTGAATACTATCTTTTGCCTTTTGATGAGGCCGATTCAGTTGAAGTTTAGTTG
CATCAATTGAAACTGGCCCAGGGCCATTGCGTGACACTTGCACATACTTCTTCCACAGATGCAGTCTCAGCTTTAGAACGGCAAGCCGTTGTTTTTCAAT
GCGCCGCACTCGCTTCCTCTCAGCTCTCTCCTTGGCCAATTGTGCTTGACGTTGAGCTTCAAGGGCAGCTTCACGTGCTTGTCGTGCTCGCGTCTCCGCT
AACTCTTGCTGGCGACGGCGCTCGAGCTCTTCTGCTGCCTTTCGACGAAGCTCTTCTTGTCGTATTTCTTCTTTTCGACGTTGTTCTTCCTCAGCAGCCT
TTATCCTCATTTCTTCAGCATGCTGCAGCACAGCAAGCCTTTGCTGTTCTGCTTCACGAGCGGCCTCTTCAGCTTTTCTGCGCTGTTCTTCCAGTTCACG
CTGTTTCTTTTGTTCGCGTAACTGAGCTTCGAGGGCCTCTTGCTGTCTCTTTGCTTCAGCAGCTTTCGTTTCAGCTTGAGCTCGGGCTACGGCTTCCTTC
TCCTCTTGTTCCTTACGTTTAGCAGCCTGCTCGATTGCAGCTTTCTTTGCTTCGTCGCGACGAGTCTTCTCTTCCTTCGCTTTTTCCAGTTCCCGCATTC
GTTGTAACATTGCTTGTTTCTTCTGCTCAATCTCTAACTTTCTCTGCGCAATCGCATCAAGCTCGTGTCTTTTCTGATTGGTATCTGTCTGTTGCTGCTG
AGACGAAAAATTATTCGCATAAGTTGCTTGAGCACTGGCAGGTGGCCCCACAGGATTTCCTTCGTTGTAGTCAACGAAATACGAGTAGTCATCCTCATAC
TCCGGCCGATCTGGGTACAGTCTAGCCCGTTCCCCCCGTTCGGAGTCTTGGATCAACTTGCTAAGAGCAGGATACTCATCTCGAGCATATTCGGTTACAC
CACGACATATATCGCGTCTTAAGTAATTGCTGCATAATTCAAGAACATTCTTGATAAGCCCTAGATTCCATTACACAATTTGCACACATGAAGCCGAGCG
TACCCTTGTTTCATCCCGACGTATATTTTGGAGCTTCGAATCTTCAGTGGCGTGTTATTCCGTCGCAATTGGACATCTGCATGCAAAAGAGTCAGCATGG
AGTCATGGATACAAGCAACCAATCGAAACCCCAATAATTCTTACCCGTTTCAAAGTCACCACCGAATTTCACAATAATTGCGCTGTCATCACCAGCTCCG
GGCCTCCCAGATATTCTCAGTTGATGTTCTTGGCATACCGAATAGGCGTGTTCAATGTCGTCAAAGCATAGCAATTCCACTAAATCTTCTAGTGGATAAA
TCTGGCTGCGATAAGCTCGATTCATACGAAGAAGTGCTGATGATCGGACGTTTGGGAGATACCGAAAAAGCAAACATGACTGCAGATAGGTTGCTTGGCG
CAACAGAGAGAAAAACTGGAAGTAATCTCCTGTATGGCGAGCTACAAACACACGCATTGCGAACTTGATGTGGGGGCTTTCCAAGATATGAGTCGGCAAA
TCTTTCACATACTTCAACACGTCCATACCACGACCATTGTCCAGCGTACAGAGGATGAAATACGCACGACACTCAGCTTCAAACGGACTTGAATATGCGG
GGTCCCCTGTCTTGTGACTTTCATCGTACAGCTCGTTTAGTGACTTGAGAGTTTGGCCAAGCTGCTCCATATTTTGCTGTGCCACGAAGCTTGGTGTCTC
AATAAGTTCATGCTCACTAAGAACGTGATATCGTGCGATTCGCTCGTGAACGTCAAGTGCAATGGGATGTACTCGACCTCCAGCACCGCGGTAATTTTGC
AGTACGAAGTCTTTACGAATCATTCGGAACCGATCCCAACAGAAGTTATACAGCTCAATTGGCTCCGGAACTCGTGGCGTTTGAAAGCGAGGATCTAAGC
CACACTGATCCAAATCCATAATTGCCTGCTCGATATAAAGCTGAGTGCGTCGTAGAACACCAGGAGGACGGATTTCCTCTGGAATATCCAATTTATGGTC
AGCTGAACTGCGCTGGAAACGCTTGATAATCATATCGCGCTCGGTTCCTGGTCGATCAGGGAAGCACTTCTCGAAAACACTCAATTCATCAACCCGAATG
TGCAGCTCACGTTCTGCCGGACTACACATATCAGCGCAAAGCCCATCCAGGTTTGTTGCTGCCGATAGTTCAGCCTTGCTACTTTCATCACGTGATGAGG
AGGCCGCCGATGGTATAGGTACAATTGAAATCTCTTCATCGCTTGTAGTCGGTGCCTTTTTCTTTGGTCGAGCTTGTCGATGCTTCCCAGGCTTTTCGTT
TAATGGGCTAGTCTTTGGCGGCTTTATGGCGCCATAAGCATCTCCATCAAAAGGAACATTTTGGCTGTTCCTAGGCACGGCTTGTTGTCCTCCGAAGGGA
TTCGTTCCTTCCTCCATCGATACACCAAATCCTTGAGCACGTTTACCTTTGTTGAATGGTGATTTTTTCGCTCCACTCATTCGCGCCTCCATTGATGTCA
TCTTGTCTGGAATTGCAAATCCTCCTACTGACACTTCTGAGCCAAATTTTGGAGTAGACTGTCGTTTAGCACCACCAAATGTGGTGGCAGCGCCGCCTGG
AGGAGAGGGCTTCCCAAATGTTGGGGAAGCTTTAAAACCATTGGCACTCGGTGCTCCTCCGAACGTGGTGTGGATTGTTGGGGTGCCTGTAGCATTGCCA
TCACTACCTGCGGCAGAGAAAGGGTTGCCCCCACGGACAGAAGATGCTGCATTCGGAGTGATCTGCTTCTTTCGTACTCTAACCCCGGATGCTTGGTTTC
CAAATGACGACACTGGGGTAGGAGCTGCTGTATGTCCAGATCCAAATCCATTCGAGTTTTGTGAGAATTTGCCTGCAGACGCTCCGAAAGTGGTCTGACC
CCCGCTAAATCCGCTGTCGTTACCACCGTACGCTGTGGTACCCCCGCCAAATGATGCCTTTGGTCCATTTCCACCACTGCCTCGATTTTTGGGTTTTCCA
CCAGCATTTGACGCCGATCCAAACGTCGTGTGCGTACCCATCGATGTAGATGAACTCGGCATACCATTCTGCCCAAATGATGTCGATCCAAATGACGTAT
TTGAATTGTTCTGCGTTTTCTTTCTTGTGTTGGTCTGTCCGAAAGGATTTCCATTTGTTGAAGCTCCTCCAAATCCGCCCGAAGGCATCGGAGGTGCTCC
AGCCAGTCCTCCAGGAGGAAGAGGTGGCTGATTGCCGAATCCTCCGCTTGGAGCACCAGCCATACCGCCTGGAGGCAGCGGTGGCTGGCTGCCGAAGCCA
GAGCTCTGTCCAAACGTCGTCTTCACGGCTGGAGCATTGTTACCGGACTGGAACGGGTTCACGACCGTTGATCCTGGACATGCGACGGCATCGATCAATA
CCTGGAGACTCATAGGTGGGCAGCAGAGCACAGCGTCGTCGCAAGAGAGAGATTCTGCCCCTTAAGGAGCATTTATCCACCTGCACTCCCCGCAACAGCA
CGAGCACGCGCCTCCACACGCACATAGAGAGAGTAACCGTAACCATGTAATCTTCCGTACCTTGAGATTGACCGAATGGGTTACTGCCTTGCGTCCCGAA
GCCTCCGAAGCCGCCGCCTCGATCTGTGGATGATGGCAAAGATGTGTCAGCTCATAACTCAGCAACCACGCGACCAATGGCAGCAGGAGAAGGTGGAATA
TGGAGGGAAATGTAAGTAGAACGCACTGCCGGAGGTGAACATCGTGACGCCGTCCAGAGAGCTTCTGTCGCGGTGTGGAAGTGTCGTCCTCGGTCAGGTC
ACCTTTGCCCGTTAGAAGCGCTATAAAGCTAACTGTACCCCCTCCAAGCGGTACAGTGTACCGTTTCACATGATGTGGTCCACGTCACGCTCCTTTAAAT
TCGGTTTCGTACTTATGCGGGTTCTATTTTGGGTTCCAACGTCATTCGACCAATCATTGGTCGTCGCATACAATAACCAAGTCATGAGCCTGCGCGTTGG
GGAACCACCAATTCTCGAGTCGCTAGCTCCGCTTTGTTGTTTGCAGCTCCAAGTTCCAAATTGCCCGCAACTTTCTGAGTAACTTCGCGCGAAGGTATTG
TGCGCATGTGCTGGCCCATGGTGAAGACGGAGACTTACGCGCTTGTATCTGCAGTTGAAAGATGGTGAAGCACAACAACGTCATCCCCAACGGCCACTTC
CACAAGTACTGGGAGTCCCGAATCAAGACTTGGTTCGACCAGGTAAGATAAGCCACAGCAATGTCAATAGCCAGCCAGCAGCGATAGCTGCCATCTACAG
GACAAAGCGTACAGGTCAATCAACAGAAGGACAATCAGGAAAACAGGCTCTGGCTGGCTACAGCTACTGAAGCCATATACTGATGCAAGTGACTCGTTGT
GACGTCTACAGGCTGCCAAGAAGAAGACCCGTCGTCTCAGACGTAAGGCCAAGGCTGCTGCCATCGCCCCGCGTCCGGCCGCTGGTCTGCTGCGCCCTGC
TGTGCACTGCCCCACGATCAAGTACGGCTCGAAGGTCCGTGCTGGCAAGGGCTTCACGCTGGAGGAGCTGAAGGAGGCTGGCATCAACCGCAAGCAGGCC
ATCAGCATTGGCATTGCCGTGGACTTCCGCCGCACCAACAAGTCGGTCGAGTCGCTCCAGGCCAACGTGCACCGCCTCCAGGCCTACAAGGCCAAGCTCG
TGGTGTTCCCGCGCAAGAGCAACAAGCCCAAGAACGGCGACGCCGCTGCTGAGGACATCAAGAACGCCGTGCAGCACACGGGCCCCATCCTCCCGATCAC
GCGTTCGAGCATCAAGTCGACCACGGCCGTCATCACGCCCGAGATGAAGGAGAAGAGCGTCTTCGCTCAGCTCCGTGTGGCTCGCGCCGACAAGCGCATC
TTCGGCAAGCAGGCCAAGCGTCTGGCTGACAAGAAGGAGAAGAAGTAAGTGTCGTACGCGTCGACATCTGCTAGCTTGCCCTCTTGATCGACTCGTGTCA
GGAGGGACGGCACTCCCTAAGGTCATTGCGGAAAGTTGGAACACAATACATCGCGCATCAAAAAATATCGTATCGTCGTGGCATCTTCTTCGTGCTTAGA
TGGCGTGTGTATTCATGATTCATTATCGCGTTTAGACTTGGAACTTCACTTCTATCTCTACTTTATACCCGCACGTCTGCATTCGCTTCTGGTCCCGAGA
GCAATGGCTGCTTCTCGGTCTCGTCTGGCTGCAATGAAATTGACTTGAGCTTGACGCGACCTCCACTAACGTTGGGGTTTTCTGAGGTGTCAACCTTCTC
GGGCAGCACACTTAGGAACATCAAGACAAGCAACTGACCGACAGACGAAATCACCACGACTAGCCAAAGATGATTCCAGTCTACAACCTTGGTAGTTGGG
TCAGGTACGATGCCCAGTGCCGACACCACGAAGGAGGTGAGAACACCAGATATAACACCACCGAAGTCCATGAACGAGAGATACAACGCGTACGTCAGGC
CTTGAACATCAGGGTTAGCTGGGCAATAGTAAGTTGCCACAACCAGCAACTGCAGCAGCGCAAACTCGGAGGTGAAAGACGTAGTGAACGACTCGACTGT
GCTAAACGTGCACACGGAGACTGGGAGGTCGACAATAGGCGGAGCCAGCAGCAGTTTTGGGAGTCCAGCGGCAACGGAAGACATTGTCGACAGAAAGAAG
ACGCTTCGGACGTTCTTGTTGGTGCACCATTTGGCGTACACCAGACACGAGAGGAAGCGTCCGATCATTCCAGCCAGAAACATATACTGCAAGCACTCGT
GCTCGTCATTGAGGAGTGAGAACGTGTACTGATACCAGATCGTGCCGTCGTTTGGCAATGCATTGCACAAAAAGAAAAACAGCATCGGCGGTAGCACCGG
TTTCATGAGCTCCATTTTGTGTTGTACATCTCGCTTGAACGGGAGCCACCACGATCTCAACGTGTTTCTCCACGAGGGCGAAGGGATCATCCCGTCCACC
TCCAGAGGGGGGTCATTGGCTATAGCTTCATAAACCGGCGTCTCCTTCAATCTAAACAGACATACTCCAGCCGCTGCGAGCGGCAGAGCACTCGTCCATC
CAATGACCTGTTGAGGTCTGATGCTATTGTCTAAGTACACCGGAATACCCAGCAGTATAGCCATAATGGACGCAATGTTCTTCGTGCCATTGGCCCATGA
TTGCACAAGAGCACTGCTTCTACTGGTGGCGTCAGCTGTCGTGAGGTTCACCAACATGATGCCGAGCATCATCTGCGCAAAGGCTTCGGCCACTGCATCC
ACGAGCTTCACGACGAAGGCACCAGCAATAGAGTGCACATACGTAGCTGTGAGTATCAGTGACGTAGCTGCACAGATCTCACAGAGAACGATGTAGGACT
TGCGGCGGTATCCGAAGAGCGGCAGACTGTCGGACAGCAATCCGTAGAGTGGCTTGAGGTTCCAGGGAAAGAATGTAACCGAGTAATAGAGCGCTGTGGT
AGCCGGTGGCATGTGGATCACGTCGAAGAGCCAAGTGCCGTATGCCGTTGTGGGGAACGTCATGAAGAACGAGTGCAGGAAGTAGAGCCCCAGCAGCGCC
ATTGGCACTTGTGTCGGTGTCATTGCTTCAGACTCAGACTCTCTCTCATCTGATTCAACATGTTTAGGACACATTAGTACGAAATTTAGTATTGTATCTG
ACGGTACGCATATGGAGTTGATTGGCTGAAAGATACTACACTATTTTCTACCAATGACAGAAGTTAAATAACGTTGCAGACACTTGACCATCGCCTGGCG
GAGGACGCTCGAGACTTGGCGACATGGCGCGCAACGAGTTCAACATCGATGAGGCCGAAGACTTCGACGACGGTACACGCGCTGTGCTGCATGAGGACGC
GGCGTCAGACTCTGACGAAGCGCAGAACTCGATGCGTCTGCGTTCATCACGTAAGCAGCGACTGCAGGCAGAGCGCAAGGAAGGCAAACAGCGTGAACAG
GCGTCAGCTCTGCGTGTCCAGAACTGGGACGCAGGTTTGCTGGAGAGTGAGGAATATGCGGGCAAAGTGGTGAAGCGTAAGGACCTGAATGACGGCGTGG
AGTCACCTGACGAAGACGCGATGGCTGAGTGGTCCGATGCGGAACCGTTCGGAGCGTCGGAAGAAGAAGAGGAGAAGGAGGAAGAGGAGGAGGAAGAGGA
GAGTGAAGAAGAAAGTGACAACGAGGACAAAAGTGCGGAGATGCTCATCCGTGGCTTCCAGAAAGAGGATTCGGCGCGGCTCATGGGTGCGCAGGATAGT
GAGAAGGTCGTGGAGAAGGCCAAGCACGTACGTAACCAGAAGCTCATCTGGGAGCGCTGTCTCGAGGTGCAGATCTACACCAAGAGACTGCTGACAACTA
CTAAGGAGGTTGCAACTCATGAGACGGATGGTGAGACCACAGACGAAGAAGTAGCTAAGACCAAGGAACAAGTGGTGGCGGAACTGTACAAGAGCATTGA
TGCAGTATCAGCGTTGCAGGAGAAGTTGTGCAATGTTCCGGAGCTGAGTGCTGCCGATGCACCGTCGAAGAAGCGCAAGCGGGCTTGTGATGATTTGTGG
GAGGAAATTACTATGACAAACCGTGCGATGCTCCCTCAGTACAACGATATTCTCAACACATACACGCGCAAGACAGATTTGGCAGCGGGTGGTAAGAACA
GCCAAGCGAAGAAGTTCAAGGCTGTGAACCAGGATATCTTGGCGCAGGTAGAATCCGTGCTGGTGGATCCCCAGCGAGTGAAACGAAAGGCACACGCTCC
GTTAGATGTTCCAGAGGCCGAGGCAGCGGGAGGGGCTGAAGACCTACTGGATGAGCTCATGTACGACGACTCAGACTTCTACCAGCAACTTCTTAAGGAG
TTTATTGAGAGTGGTGGAGGTGGCGCTGGCCAGGATGCCATGGTGCGACGCACTCACCGCAAGAAAAAGAAAATTGTGAACCGCAAGGCTAGCAAGGGCC
GCCAACTGCGCTATACGGTGCACCCTAAGTTGGAGAACTTCATGTTCCCAGAGCCTTACCCGAAACCAGAGATGGACGTTGACGAGCTTTTCCGCTCGCT
CTTTGGCCAAGTTCGGCAGTAGTCGAACAATAGATTGATTTTTGCTCCTAGACTTAGTGCTTAGTGCTGCCTTCTTCTACTATAGAAGATATTCATTCTA
CGCCGCAAGTTGGCGCGCTGCGTTGTGTTCGAGGAAGACACCCCAAGATATCCTTAAAGCACATCGTCTTCTTCTTCCTCTTCCTTTTCTCCTGATAGAT
ACACCTCCTTGATCTTGGCTAAGTTGGCTTCCACCTCCCGTAGACGCACATCATTGACCCCGTTGGCGCCAATCTTCTTTACAATACCCACCAATGTGAT
TGCCTTCTCGGCGGCATGCACCACGGTCAACGCTCGAATTTTCTTTGCTCGTGTTGCATTTTCCAAGGACCGGAACTCTTCTTCTGCCAAGTCCATTGAG
GCGTCGGCTAGCACTGTCGTAGAGTCGATGAGTGCACTACCACGCTCCTCGAAGCGCTCAGGGATATTGAACGTGTGCAACTGCCGTACTTCCGTTGCAT
ATGAGCCACTCTTAAATACTTTGTGTTTGAGCTTCACTGTATCCTTCAGCAGTAAAGTGAACTTGTCGATCAGCTCTGGTTTCCCCTTTGCAATAGCGCG
CATAGTTGCAGGAGCGTTAAGAATTTGCAGGCGCTTTGCAATCAACTGACCCGCATCACGCTCCAAGAACGACAGCCCCCACAACCGTCCATACGCTTTA
CCAGCGTCCATCCGTTCCTGCTCGGAAAAATACCACTCTCGGGTGTCCTTGTTCTTGATGAGCAGACGCGATGACCAGGTCTGAACTGAGTCAGTTCCGA
GCGCAAGGCCATACTCCTCAAGTTTTGGAGCGATCGTTTTGTAGAAGGAGATTGCTTCTTCGTCACTAGACAGCTTCGTAGTCAGCAGCTCTGTCACTAA
GCGATTTACCTCTTCGCGGTTCTCCACCAGCTTCTTGTTGCTCTCCTTTCGCGCTTTTTTCTCGAGCTGTTCGATCATACTCATACCACCAGGTCCTTTA
GACTGTTGAGATTCATCACCAAAGATATCATCAATGGCACTTTCCGCAGCAGCCAGCTCTTGGGCCATCTGATCTTCTACGGAGCGTGGTGGCAAACCAT
CAACAGCAAGACCACCTCCACTAGTTCCACGTCCACGAGCACCACCGCTTAAACCTCCAGTGTTTGACACTGTATCAACCGCAAACAAATGTGTATCAGC
AGCGGGTTAAAGACATTATTTCAACCATGTCAACTCACCTTGTTGAATGATCTGTTGGTGTTGCATCAAGATGCTGAAGAGTTGCTCCATTGATACAGGT
CCGGTAGGAGAAGCTGGTGCTTGAACAGGTGGCTAGTTCAAGCGGAGTGAACAATATCGAAGTCAGTGAACTTTACTAAATACCAGCATAGAACGATTTA
TAACGTACACCAGGATCGTTGGGCGATACCTCGTTTGGGCGATCAAGCAGGTCGGGGTCTACCTCTTCTGCCTTCATCTTGAGCTTGATCTGCTCGTCGG
GCATGCCCATTTGCCGTAGTTTGAAATATTTCATGAATTTCGGGTCGTCTTTGACATGAAGTGGCTCGTAAGGAACTACAGGGGCTGCAGCGGGCATTGA
GGGCCAGCTAAAGCCGTTTGCTCCTTGCAGTGGAGATAATGGTGCCATTCCATTGGACGGATACCCTGCAGAAATCTGTACTGGTGGCTATATTGTTTCA
TAAGCATCATTCATAACCACAAAATGGATCAGAGTACACTCCAAGAAGCACGAATCCTACAGATAGCAATAGAAACGTACACCAGGGTCATTCGGCGATA
CCATATTCGGAGTATCGAGCAGTGCGGGGTCGACGCCGTCAGCCTCCATCTTCATCTTAATGTGATCGATCGACATGTCCATGCTCTTCAACTTGAAGTA
TTTTTTGAACACTGGATCGTCCGCCACGGTCATCGGGATGTACGCACCCTTCTCCGGCTACCGACAACAAAATCCAAAATCAAGCAACACATTAGCGTTA
TACAGCAGCAACTTTCTGCGCAATCGTCAACTTACACCAGAGTCATTTGGAGACTTTGCATCGGGTGTGTCGAGGAGATCTGGGCTAACACCATCTGCCT
TCATCTTTGCCTTGATCTGGTCAATAGGCATTTCCATGTCTTTCAACTTGAAGTACTTTATGAAACCCGGGTCGTTCTTCACCAACAGCGGCGTGTATAC
ACTAGTCACTGTCATGACGTTTCCTGTCTGTTGTGCATAGACATTCTGCGTTTTCTTCTCCAGCTCACTGAGCTTCTGCTGCAAGGCCTTGATCTCCTTG
AGACTAGCTCCAGAGACTGCCCTCTCTCTCGTTCCACCATTCTTCTTGTCAGCCATGAGCTGCGAGATTTGTTTCTGCAGTTTGTCAATTGACGAACTGG
TATTTACTACATCCGCTTTGGACGCCAAGTCCAGCAGTTTCGTGATCTGAGTGGGTGTGAGACCAGGGATAGCGACGCCACCTCGTCCTGTAGAGAGTGG
GGCGTGGGCCACATCTTCACTCTCGGAGTCACTCTCGTCGTCCTCATCTTCCGACTCTTCTTCTTCCTCCTCATCCGCCGCTTCCTTTTCCATCCTCAGC
TTGATGCAGAGATTGCGGTGCGCACGTGCGTGTCTCCTCTTACAAGTCTGTTCTCAATAGTCATACCATTTCTTTTTTAATGATCCTTCTTAGTCTTAGT
ATAGCGATCAACAAACCTCGTTGCAGTAGAAAGCTTTGCTGCAGATCGTGCAGGGCAGCGGGGCGTTGGACGCCGCACAGTAGGCGCAGTCCTCGCCTGA
GCCGGCTGCAAAGCTCATGCCCATGCTTGTGAGGCGGCTCATGAGCTCATCGTCGCTGTCGCTGTCCGCCATGGCGAGATGTGCGTGGCACGAGGTTTCT
TGGACTCTGAATCCGAACTCGCCCGTTTCTCATGTTGAACTCTAAAAATAGCCCAAACAGGTCGGACTATTTGGCTTTGATGGGCATCGACAATAAACAG
GTCGGACCATTTGGGGCTTTGATGGGCATCGACAAGTGGAAAGCTCGAGGAAATCCTCCGTTAGTAAACAAATGCACTTGTCCACATTGTGACAGTCTAA
CGAGTCAGTGCCTGAACGATCCTTATCATTGCACGAATGAATGAAGTGTGTCATGTGTATTGCTGTGCTACATTATGAATAAATAGCGCTGCATGAGGCG
AAGTTATCATGTTTGCGTTCTTCGATCGAACACAATCGGCCGTTGCTGCTTTTATAGATAGGGGTTGCTGTGGAGGAGAGGACTGCACTTCGTCCTCCCC
TAGGCTGCAACGCGGGACAGACGACGCTGCGAGAGCATACGCACCATATCCGGAGACTTTCCGGTCTCGCTGATGTTGAGCAGGTAGTCCGATCCCACCT
GCTCGTTGGTGACGATACCCGAGAACCGCTGGAACAACTCGCAAATGGTGGCATGACCATTGGCCTCCGCAATCATCATAGCATCACTGTCGTTCTTGGT
GCGCTTTTCCGGGTCGGCGTCGTGCCGTAGCAGATACTCGGAAATAGCAAGCGAGCCCAGCTTGGCCGCGAAGTGTAGCGGGGTGATGCCACTGGCGGTC
ATGACATTCACGTTGGCGCCACGTTCCACGAGCATCGCAACGATTTCGATGTTCTGAGAGACGATGGCGGCATGAAGAGGATATGTGCCGCGCTTGCTGC
AGGTGGATACCTTTGCGCCAGCATCAAGCAGAAGCTTGACGACATCAACACATCCATTGCGGCACGCCGCGATCAGGGGGGTAACACCGGCGTCGTTCCC
CTTATTAGCGTCCGCACCTTCGTCTAGCAGGAGGGTCACAATGTCTTTTCGGCCCATACGTGCTGCAATGTGCAGACACGAGGAACCGTCACTCATAGTG
GTGTTGGCATCGGCGTAGTTGAACAGGATCAACTGCACAGCGTACAAGTGACCGATGCGGCACGCTACATAGAGACAGATCTCCCATCGGCGAGTTTGCG
TGAGTTCGGGTGAGTTCAACTCGTCAATGTCGCTTGCGAATTGGCTCAGCACGTGTTCACAAAATTCCTCCATGAACGAATGCATGGTGTGAACGCGCAC
AGGCTTGACTTGTAAAGACGGAAGAGTTAATCGCTCGGTTTCGAAGTCCTTCTCTTCATTTGGAGAAGGCGTCGAATCCTCGTCAACTCTAGACTCATCA
GCACGTATCGCGGTAAGATGAACCTCGCTAAATTCAGGAACGCTGTCTTGAAACCCACCGTCTTCTTCTTCGTCTTGACCAAGCATTTGATCGGCACATT
GTTGCCTCCAGCCATTCAACACCAGTGGACGGTGCAACATGGCCGATACGCCAGTTGGGAAGTGCTCGGCAGCGCCGAGGAAGTTCGCGTACGTTTTGAG
CACTAAACAGCTGCCATCCTGCAGCTTGTTGCGCAGCGTCGCGCTGGCAAAAGCGTTGAAGAACTCGTGTAAAAGCGCAACAAACGCCGCCAGCGCATCA
CGACGTTCGTTAACTGCTGCATGATCAAGACCTGTAAGCTTGGAGCGGAGCGATCGGCGTGACGGGAACGGAAATGATTGTAGTATCGGGTACAGTGCAT
CGAACTCGCAGTGGTCATTGGTACAATGGCATTTGTGCGCCAACCCAAGCGTGAGATGATGTCGTCGCACAGTCCCAACCGGTTCATTCACACGTTCACG
AAGCGTCTTCCAAAGGCGTCGAAATTGCGAATACGACCGCAATGTCGTGAGAATTCCATTAGATGACGGTGAGATTGGCACTGGTGCACGAGTGTCGTTC
TTGGTGAGTTTGATGGCGAAAAAGACATTGCCGTCTGTGACCTGATAGGACGGCACGGCCACATCGTACTTGTCGATCCAGCTCATGTTGGCTGGCGGCT
ACTCGTTTCTTTGTCGTATTGGCAAGTGTCGTTGCTGGTTTCAATTGATGTAGAAGGTGGAGAGTGCCGTTGACAGACTTTCAACGCGAAAGGATCTCCG
TCAAGAGCTATTCGTAGATGAGGCAGTAAATAGAACCTCGAAGGGTTCTGTTAGTACGAGTCCGCTGCAAGCAGCAAGGACTACGTGGATCTTCCGCCGC
GGTGGCAAAAAGGAGATTGGCATCAGCTGCGGTGCTCAGACACAGCAGGAATCGTCGTAATGTGGACCGAACATTTCGTGTCACACCCCTTCAACGCGGT
TCTGATCCTCCAATAGACGCGCCAGAAAACCGCTTTTCAGCCAATAAACGCGCGGTCCCACCTTCACAAAAGAGTCGGACTGGCTCTGTCGAAGCAATAG
CGTGGCTGAAATTCGCCCACGACCTCAATTTGCACGTCTTCGTTGTTACTGCGAGGCACAAACCTCAAAGTGATCTGACCAGGTCAAAGCTACACCACTA
AAACCGTGCAATTCCGTCGTATTTTAGAACGAAACGTGTATTTACTGCCTGTCGAGTTGAAGCTCTCGGGTGATACCAACGCACAGGCCCACACGTGAGA
GGACTGTACACTTTGTACCAACAAATTTTGCGCTACCAGCTGAGGAAAATACGATTGATGTTGTTTGTGCGACGCACTTGCTAAACTTTGACAACACAGC
CGATGGATTTTCGCAGCGTTCAAACTCGAGCTTTGACCCAGCCGGCTAATGTGTAACGTAGGGTCAGCTGGATTGAACCGCACAGCACATCATGGTCAAT
GAAGTTGAGGCATCAGAGCCGCAGATCCAGTGGAGAGGCAAGCAAGTCTGTCCGATGCACTGTGTTGAGCTCCGGAGCAGTGAACTGGGCTTGAAGTAAC
TGCAACGGGTCGAACTTCTTCTCAACGCGATGCTGACGATGTGCACTCCACGGGTGATCGCAGTTGCAAACCCAAGGACTATAGAGCACCATGCACGTCG
AACCGTGAACACCAAATCAAATCGTTAGCGGTGGATTTTTGAGTGAACAACATCCCAGTAGCGTCCGATCGAGGCACTAGTGCGACTTGCAAAAAATTGT
ATCCGCGTACGCACCTGTCAAATCCTTGACAGTCACACTTTGGCTTCTTGCACACGAACGGTTTGCTGCCCGGGTCGTGATCTGTGTGTCTATGTTTGCA
TCGGCATCGTAGGATCCAGGCGCCTTCAGCCACGACGTAGAAGAATGCTTTGCATGAACATGTAGCTGACGTGCACGCAAAGGCGCGAAATGTTGCAGCG
GATTTCACTCGAGGATCTTCAGCGCTGCTTGGGTGCTCTTTGAATCGATGTCCACTGTCAATGTAAAAAACGGCGTATCAATTCCAGCATTGTATCCTCT
CAGTAAAAACAAAGCATTACCAAAGACAGCGACTCTCCTCGCGAACAGGGATACACTCGCGGTTGCATGTGTCACATGACCATTGAATCACCATCTTAGT
GTAGCTCTTCACTTTCATTGGAAACGGTGCCGGGATACCTCCAGACATCGGGACAAGCGCGTTTGGTGCATGAATAATTGGTAACGTAGACTTTCCCTTC
AGCTCCGAGAACTGCTGCCTCAGCTCCGACACCGAGATTTCATCCTGATTACAGATAGTTGAAGTTTCAGCAGCTGGTAGATTTGCATCTTCGGGAGCCA
ACACCTGTAGTGTATGCATGCCAGTGTCCCGATATCTAGATTCTCTTGATATGAGCTGCTCTGCTTGTCGACAACTCGCATCCTTATGTTGATTCGGTGT
TACCTCCCGTACTGCTACCGTGTGGTGATTCGACTTTGATCGGCTTCTTCCACTTGCTCGCAGTTTACTTTTCAAAAGCTGCAAGGACTGGGTCCGCACA
GCGAAACCCTGCTCCATTGTGCTCGAAAGCCCCACTTCTCGAGTCTCAAGGTAGAAATTAACGTGCGTCTCTTCAAATGCTTAGGATTCTGCTTTCGCGC
AATGCGAAGGTTGGTACTAGCTGCTTGCTGTATCATTGCTGCAGTCTACACAACTGAAGCGTTAGTTTGCAACGCTGGAACGTACTTTGATGGTGCCAAG
TGCTCGCGCTGTCCAGGTGGCACCTTCGGTGTCGCACCGGGTCTCACATCGCCAACGTGCTCCGGTTTGTGTTCGGCAGGGTTTTTCTGCCCGGCAGGAT
CGACTTCATCTCGAGCAAAATCTTGCGGCACCTCCATCTTCTACTGTCCACCGGGTAGTGCTGAACGTCAACGTGTTGATCCGGGATACTACACCATCAC
GTTTCCGACTGATCAGAGCAACCTGCCTCTGATTGACAGCTCCAAAGGTGGTGCTGGAAAGCAGATACGCTGCGAAAAAGGATACTACTGCGTCTTCGGG
ATCCGGCGAGTTTGTCGTGCTGGTGTGTTTGGAGATTCGACGAGACTCACCACACCAGAGTGCTCGGAGCCGTGTCCACAAGGGTCGTACTGCCCAGAAG
CTACAAATGTGCCGATTCCATGTCCACCGGGGATGTTCGGGGGCGAATTAGGTCTAACGAATGCTCAATGCAGTGGACTCTGTCCAATTGGTTTCTACTG
GTACGTTTAAAGCTCAGGGCTCTGTTGTTCCAGTGCACTGGTGAGCTCATTCATGAATTATTTTGCAGTGAAATTGGGACGGTCACTCCGACACCATGTC
CTGCAGGTACCTACGGAGCAACTCAAGGTCTCATCAGCTCAGCCTGTTCGAGTAAGTGCTCTACAGTCGGCGGCAAACTGTCGTGTCTCCCATCACCTTG
TCCAGCTAGATACTACTGCCCGCCTGCTACAACGGTTCCGCTTGAGTGCGGAGCTGTTGGCGTATTTTGCCCCAAAGGTTCATCAGCACCAACGACTGCT
ACAGCAGGTTACTATACCACTTGGAAAGCAGACATAGAGACATCCGTGACAGAAGAGCAACTTGCATTGGACTACGTTGAAGGTCACCACTTTGCAGCTC
AAAACCAGTCAACTCGATCCAATCAGCATATTTGCGAGAAAGGTTCATACTGCATTGGCGGCGTTAAAAGGCTCTGTCCTTCTGGTACGTACGGCGCCAC
TGAAGGTCTCTCCACTGCAGCATGCACAGCTCCCTGCCCTCCTGGCTTCTACTGGTACGTAAATGATGCCAGTATTTGTTCATACCAACAAGAACTTAAA
CTGATTTTCCCGTTCGTATTTCAGTCCGATAGGAACAGCAGATTACAACTTGTTTCCGTGCACGCTGCGAACATCGTTTTGTCGCCAAGGCTCTTCAATA
CCGATTGCTGTCGATGCTGGATATTTTACGGTAGCGACACTAGCGGGACTTCGTACAGACGAAACTATTTGCCCCATTGGAAGCTATTGCGTCGAAGGGG
TTCGACATCTTTGTGGTGAAGGCTCATACGGATCCACCCCCGGTCTTACATCGAAAACCTGCTCCGGTAAATGCCAAAATGGATACCTCTGTCCACAAGG
ATCGACGTCAGCGAAGCAATTACCCTGTCAAGCGGGGTCGTACTCTCGAAATGGTAAATTTTGCTCGCCTTGTTCTCCTGGCTACTGGTGCGATGCTGGA
TCTCCTGATCCTCAGCAACATGAGTGCGGTGCGGACAACAAGTTCTGCCCGCTTGGGTCATCAGCAGCTCAACTAGTCCGTGCTGGTTATTATGGTGTTG
GACAACAACTCAATACCCACACCTCTGAGGCGTTCTGTGTAATTCGAAATGCTCCACATCTTCCACAATGTCCTACATGAACAGTAAGGCAACAAGTGTA
ACATGATAACAAATTATTACCATT