Description :
From Genome Similarity Track
Location :
Scaffold_82:77615- 82356
Transcript NameFunction/comments
Phyca_LT1534129232predicted protein
Phyca_LT1534129198serine/threonine protein kinase
Phyca_LT1534129207transmembrane protein, putative

Sequence
4741 bases(100 bases per row)
aagagtctgttcaagatgctgaagaaacttgcgtcaccgaaaaaaaaagcgcaaggaggaggaaggtaggaagagtcgatagtcttcttggatttaatac
taaattctcttttatttttttagtgatggacaggacactgcaggatttggtttagactcgccaaaatctccagaagcgaagattaaatctccaaaggaga
agaaagtgaaggaaaaaaacaagccgaagcctccgaaggaaaagaaaaaggagaaatccaagaaacccagtacaacacaagaggttcctagtggtgatgc
caaggaagttgatgttcctacggctgaagtcaagactccatcacctcgaagatccttaacgcgtgcatttaaacgcaaaacttttgaacaggacaatgca
cctgaagagaaggttgtgggtaagaaacctccgtcttctcccaagaaaacgtaagtcgagttttcgtttttaaacaggtgtagtattaccctcagttctt
ctacagattgatgaagcttccgaagcctgacaaaaagcccacgcttatagacaagaagcaaaaggctaaagctttggagacgcttgatccaagtcaagaa
cagccagcaacaacagaaaaagacccactcacctcgcctaaagcagacattgaagtcgaatcaccgaaacgaaagtctcgctggaaaatccccgacagaa
aacaccatagcaagtcatcgaataatcaaaaggagattaaagaatcgactcaagaagagaagaacttgaagccaccattatctccaacgagcgataacaa
cgctcccagtagtcgtgagaactctccctctccacgtgttcgaagcaataaaaccaagaaagggaaaaataccaaacgccaactatcagtcgacagttcc
agcggcgacagcgagcaggaaaaccagacgaacgctttatctccacttcgtcgtcacagagctgaccccagcgatactttaccgataccagagtctcctt
acgttccgtcccgacttcaaaaacgccttacacaacttgatgtgccacctgcgtaccaacctgaagtgcatttggtcggtgagatcgtcagtggccatgg
attcgggactgccgggggtttaacgtgtaagtggcgtgtcgagtacggcagtcgatggagtcacattgctggtgatgagttcggccaaactcaattggat
tatccatcgactgcgccatggacgtcggagccggatgtggctgtgtggtctcatccgattgacttgcattttgcaacatcagcgttccaaggctggccga
aacttctgtttcaagtgtggagagcagactccagcatgaaattgcacgttgtcgggtacggcttcgtccctgttccctttgcagcaggtcaacacaagct
ctgggtgtcattgtggcgtccacttgggagtactgtagaggaaattgatgctcagattctgggacggacaacagaactcaaaagcgacgatgttttattt
agtgctgcgtggtcggagagatgtcgactgcgaacaattgctactgggagagttctcgtgcatattggagtactactacgacacttccaaacgggtgcga
tcgaagcctaagaagacttgaaagtaaaaacaaatttgaagaactaaaggctccacgtgggggtgaatgaaaaacactacatgtagtttctcgagcaaaa
tctcgcttaaacttattcgcgacgaggtttcttgcggctagttgctgcacttccaccgtaaagtttctgaagcgtttcaagctcttcccggtatttaacc
agcttcgcttgacacgagtcaaaccacagtcgagtcttcgtgatcgtcagatacgcatttttacctttaccagcaggcgtcatcttgaatgaggccccgt
gctgcttggtacgagggtatttacctgcaaatttccgagcttcagggattccactgaatgttaccagtccctgcgtcttcatggaagtgtcaggtccacg
caggaaatcttcaatttccttgttatcagggaattttgcccctggcatttcccacgaaaacttcgtatccatctttttaatcttttctttcagccactcc
atccgacgttcagcaatcgaagtcagtgctactcgtttgacactcgattcctcaatatccccaatatattgcgagaacaactcgactgcagggccaaggc
gcttcggctttttcgccttgaaatatgtcgcgacggtatcgaaaattgcttgatcagcagattggacaacatgtttccagaacacgccagctactttgga
cgagttcaagtcttcagatgaactcgaggatttatgctgcttgtcgactctcaatgcttcttccacagccaatttaagtagatccttccgagctacgtcg
ccttgaacgttatccagcacttgcaccgtcatctccaacgaggtgtcaccaggaatctcctcttcgtcgtacccacttccgtctctacttaacttgtcca
tgatatcctttccaatcacattccagtcaaactgcgcgatcattttcgtaatgacaggaagaagactcaagttttcactcagcaaccctaagctagggaa
gtacttggacaagaaggtcttggccagatcaacatcacccgtttccaccagaagttcacaaaaggaccggcaaaatctcggtgaagcttcgttgtacctc
ccgagccttttactcaatgtatccaaaaattctccaagtgcagtgacttcaataggcctctgctcaaaaagcgcctccactgcaagttctgcgggcatca
cctttaaggcattctcggcgtgtttcaccgctggccaggcgacaattgcgaaggtggagtacttggtatttagcgtagggccttcgttcccagtataagg
cttttcaactctatgcccaaggtgttcccagatctgcgcaaatgttttctgacccggattcaggaaattaagcttcgagtcaaacttctcctgcttgcag
cgtcccagatattcgccagtggacgcgtaccaatcaatcttttcactacgttcctcttcttgccaatcttcataacaagccctggcagggcacgaaatga
tttttagtgacaactcggcaatgaaaaaccgaagttttctgtcggatggtaccagcgcattcgcttcctcaagtgcgcggaatctggcactgtcctctcc
tttgagagcacccgtgcccagttttacaatactgtacttcgtgtattggtgtgttagcaacaaggccagagactcttcttccgacaccatttcgccgatc
gcatcagctagatcatcgcatgtgggcaagctggaatcccgttcaaggtgtctcattgttggtggtagacaaagggagtagaccagtgcgaggcgataac
cttttgtcaccttttccaaggcatgctccgcatcggcatagtggacggcgaagtgcgtcgagaaggcggctgtaccgtcgtttttgccgaaatcatggcg
atatctctccttgccacctcgaaacaccactaagtctcctccttcgtgtgcacttggtggttgaactaccagagtagcgatcattccgtcctctttctcg
gtgtcttggtgtttgagaaaatgccctccttctccatataccagtaccttgtaaagaacacaaagcattgggaccttttcgtaccccaagcgctgagcga
tagtcttcgtcagctcgtcaataccagaacgccattgagtgttgcttatcttcacttgatccggcgccacttgccaactcttgcgtacattctcgtccat
tttcgtttctagattgtggccgaagggggatttttcacatttctcgatcagtttttcagcttgctccggaacgagaggaaaggaaatgtcccccacgcca
tcaatgacaagaccaggagcgaagggtaaagagctcgctacacccccaaaagagtactcgccagcgttattgtcagccattcctaggatttcactgatct
tcacacacgaagctccacttgggatcggcacctcatcagcttcgccaggctcttcttcaatagcaccctcaccaccaaacggccaatcgccttcttcaaa
gtgttcctcgaacgaagacatcgttttagaaccggaagcgatggaatcaacttgaaaaatgaacaaagtgagagaggtaaaaattgagaccaggagaaat
ccgattgatgtaatcagtgccaaaagcggaattctcgaaaacttttctttctcgcgttctcacgggtgggtgattgatgccttgagcttaattgctcgtc
acggattgacgtttagtcgactctgtagatcgatacgacgtttctccatcaccaccaaagtacccatccaaccagtccagtcgtgcatcttgaagtgtgg
accagtgggtgtgaattacttgatccgcaacaagtcttactggaataccattcaattccctgttcgtgtcgattaattcgtacgtgataaccgtaagatt
gaaaaaattgagaacttgaacaggaagtactcgagctacgagaaataacggaagatctcgataccgaaagagaatggaagatgccaacacaaagccactt
gcctctagttgcccccgtgtagatagtaaagtgcctccagtgccttgtacgtaaacttgtgtactgcagtcatatagcgatgttctgcgtgatcgatcgt
ccaaaaacctggtgaacgaattggcttccggacatttcgat