Description :
From Genome Similarity Track
Location :
Scaffold_11:77608- 79480
Sequence
1872 bases(100 bases per row)
TGTTGATCTCAGTTCACTATCAGGAGTCACAGCTGGCACAGTTACAGCATCCAAGTTATTTGTGGTCGATGCGAATTAAGATATCAGCTCATTTCGTAAT
TTGACGGCAGTAAATCTTACTGGAACTCTACTGACGGCAGCGCAACCGAATATCACGTCGATTGGAACATTGTCGTCTCTGAATGTGTCTGGAGGATTGA
CAGCATCTACGCTGACTGGAACGCTTAGCACAGCAGCTCAACATAATATTACATCGCTTGGAACTCTCACAACTGGATTGCAATCAACGATCAGCAACAA
CACAACTTCATTTGCAAGCTATGCGCGTTGGACAAACAGTCTTATTACGCCAATGAGCTGTGTGCTCGAAGTGTCAAAAATCGCGCCTAGGTTCGGAGCA
ATCTCGCAACATACTTTTCGTATCTATTCAGGCAATGCAATTGCAATGTGGATGGACGTTAGCCAGAACGTGAGAATTGGAACCGTAGCACCATCTGGAA
CGTATAAGTTAGAAGTAGATGGATCTATAAACGCTGACGCAATTAACATCAATGGAGTTGCAGTTGCTTTTCGGCTGATATAACATCTATCACCGGTATC
ACTGCGGGGATAGCTTCCGCAAACAAAGCTTTGGTTGCTGACAGTAGCCTAAATATCGCTGGAATAAACTCTCTCAACGCAACATCATTGACTGGAACTT
TGCTTACTCCAGCTTAACCAAACATAACGAGCGTTGGTACATTATCTAGTTTGAATCTGTCGGGTTCAGGTATCACTCACACACAGAGTGCTGGAGGCAA
TGTTACTTTATTTGCTAACTCAACAGCTATAAGCACGCTCACCATCGGTATTGCAAGTGCTGGTGGCGCATGCGATATTCGATCAAGTACTGCAAGCGAT
CTATACCTGGATGCTAATAATACGAGAAGGCTCTCGATTAAAAGTGGAGGTAATGTCGGTATCAATACACTTCTCCAGGTTATCAACTTGATGTGAGCGG
GTCTTTTAGTTCCACCAGCTTTTACATGAACAGAGCGCTTATCACAGCCTCGGCAACATATTTGAATGAAGTAACGGGGTATGGAACGTATCCGGCTTAG
CAGGTGATGGAGGTTGAGGCGCTGGCTCATATGAAAAGTCGGGAGCTTCCTCGCTAACCTCTGATGCTGTGGATCTGTTTGCAATCTTGTTGTAGCTAGT
ATTGGCAGCAAACGTGCTATGGAGTAGCTTAGCGTGAAGGTCATGTTTTTCTCTATTAGTAAGCTTCGCATATGTTGGTGATTGGATCAGATGTGATTCA
ACAATGTGACGCATCATGTCCATTCTCATTGGCTTTCCATTGTATTTTACGAAGAGCTTTGAGAGAGCTGAACTGAATCCATTATTACTGTCATATTCGC
CTGGACTATTGTTGTAAACACGCTAAAGTAGATATGTTGGTGTTTGCCCGAGAGAGCCTGAACAACGATCAATCTTATTGCTAATTCTTTAGCAATAAGA
TTGTTCGTTGTTCCATCTAGATCAATAATTTGCGCACCCATGAGGCGAACGTTCTTAAAAATTTTCGAGTAGAGCTTCGTTCCTTGGAGGTAGTTACCAC
CATCAACTCTCTTCAGATAGACTGAGGGCCATATGAGACGCAGAGAATAATTGACATTGAGATATAGTGTGACATAGTCAAAAATAAGGCGTAGATTATC
AATTCGTTTCGCTTTGGTAAGTTTGCTTAGCTCATTGTTTGATAGGAACATTTCGCCATACGTATCCATGATAATCTTCTCGACTTTTTGTGGAACCGCT
ATCAGTTCTTGGTAGCTAATGTATTTCTTCTTTTCTTCAGGCGTGAGCTCATTATCCAATTTTTCCTCCTTA