Description :
From Genome Similarity Track
Location :
Scaffold_130:77603- 82857
Sequence
5254 bases(100 bases per row)
CCGAACGGAAAGTAACGTCTAATTCATGCTTATAAAAAGCTGAATAACGCGACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTAATAAACA
ACATGGCCGGGAGCGTATTGTAGAGTGCGCTGGATTTGTCGACGGATACTTCCAGATCCTGATGCGAGAGAGTGACATGCCCCCTCGCCTCGCCGAGGGG
GAGCACTCCAAGCGGCAGTCTTTGGGGAGTGGCTCGCTTTAAACCCGCAGGGCCTGTTTCTAAGGCCCGCGGGAAAATTTCATCGCCTGGGTGAAGGCAA
ATGTTTTCGGGCCCTTTGTTTGCCTCTCGCTAAAAGAGGTCATTTCCAAGAACATATATTGCTCCCCATACCCTGCCCAGGAGGAAAGAACGGTCATGGA
GGTGCATCTGGGGCACCTCCGTCGAGTGTTGAACGTAATGCGAGCGAACAATCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAA
GTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCCGGCCCAGACAAGGTCAAGGCCATAGCAGCCTGGCCAACGCCCCGATCCCAGAAGGATCTTC
GAAAGTGGTTGGGCTTGGCCAACTACCTTCACAGGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTG
GCGCTGCGAGCAGGAGCACCAGGATGCTTTTGACAGCACCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGC
GTCGTCTGCGATGCCTCCGATAAAGCAATCGGATGTGCATTGCTACAAGCCGACACGGTTGGACACGAGCGAGTCATCTCGTTCCAGTCCAGGCAGTTTA
AAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGGCGCTCCTGGCAATGAAATGTGCCCTTGTGAAGTTTCGTGCTCACCTCCTGGGCTCCCGGCCCTT
CGTGATCTACCCAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCAGCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGTGTAGTACAAC
TTCCGTGTCGAATACAAGCTGGGTAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCTGACTACGAGGTGGCCCACATCACACGGGTGACAACGG
ATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCATCAAATTCCTCACGGCAGGAACGAGCGCGAAGTCCGACTGGCT
CTCGTCGCGACAGCGCTCATGGCTCCACCGATACGAGTTGAAGGAGGACCTCTTCTATTACCGGGTGGAGCCCACTTATCCTCCACGGGTGGTCGTACCC
AACGACGAGGATCTGAAGTTCGATATCGTCGCGGAGGCGCATGACGCGCCCTCTAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGT
CCTTCTGGTGGACCCACATGTACAGGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACT
ACAGAGTCTGCCCGTACCGGCTGACTGTTGGAAGTCGATGAGTTTTGACTTCATCTTTGGGCTTCCCGCCGATGGACACGGCAACACCGGAATTTTGGTG
TTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCT
ATCACGGTCTCCCGGAGACGGTTGTCTCGGACCGAGACCCGCGATTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAGCTCGTCTGCAGAT
GTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGCCACGTACG
TGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACACGGTGCACGCGTCCACGGGGGTCACGCCGTTCTACTTGAACGGCTTCCGCCACCCCA
GAGTGCCTCTCACTCTTCGAGGAAACACTGACTCCTCTATTCTAAGTGAGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTAAACACAGT
TTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACAAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGAG
TACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTACTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGTCCTGGCCAGAACATGGTGGCGTCGTACACCATCGACCTTCCAAAGTCAATGACCGACGCACCCGACGTTCTATGTCCGGACGTCTTAAGCGGT
ACTTTGACCCGCAGAGAGGTTGATGACTCGCTGACCCACCTTGACCTAGCTCCTCGAAGCGAGGGCCTGTCACAGTCGTCGACGAGGACGCCGGAGCAGG
CACTAAGCCTCGGTCGGAACGGCAAGGCTGCGGTCAAGACCGTACGCCAGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCCGGGT
ACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTTGGATCATGCGGAAGGCCTCGTCCAAATC
GGACGAAGAGGCCCGGCGATTCACCCGCAGATACAGGCTTACGACCTCACGCTCCAACAGGTTCAGGCGGCTCGTAAGACGAGCGAGCTCGCCCTGATTC
CCGGCCTGGGCGGCAGCATCACCACCAGGCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAACCTCAGGGCTCTGTGTCG
GACCCGCAGGAGAAGCACTCGGACGGGAGTGGCGTAAGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGTACCTCCGCCCCTGCTTGACCGGAATGGAG
AAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGGTAAAGCGACAGCTCCTCGTGAAGAGGAGGGGTTATGCCCACTCCGAGAGC
TCGTGGGAGCCGATTGAACGGCTCCCTGATTGACTGCCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTC
TTGCCTGAACGGGGTACGGACGATGAATACATTCCGTACCCGCGCTCATCGTGAGCGCTAGAAGCCGCGCACTTCAGGATGTCCCTTGGTAGCATACGCT
TGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGGTCCAGGATGCGGGACAGCAGCTGGTCTTCATGGAGCTCCCGTAACTTCGTGGGTGAGTA
CTTATGCGCTTCCACCCACGCCCAGAACATGTCTTCACAAGAACTCCACGTGGGACAGTTCTCGGGCATAACCCAGGGGTATCCCCAAAGAGGATAGAGA
CCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGTAGCCTCCATGTTGTCGA
CGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAG
GTCAACCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCTCCGAACCCCCACGCACACGCTGG
GCAGCTTGGAACTCCTCCTGCTGCTGGTCGAGGTCATTCGAGACCTCCCGGGGCTCAACGATAGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCT
CTTCATACGAGAAGTCGAAGATACTCCGAAAGGAGCGAAGAGTCTCCTTCTCCTCGCGGAGTGGAGACTAAGAGGCGGTACGCTTCTTTGAGGACTTGGC
GCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGATGTTTGCGAGGATTCTCTTCATCATCGCCACCGGCTTTGGGAGCGCCC
TTAGCCTTGTCGGCCGGACTCTCAGAGCGCACAGAGGTCCTGGGACTGTGATCACCTTGATTACTAGCGAGCGACTGCACGCTGTCATCTTTGTGCTCAC
TGGGCACTGGGCTGTGCCCCCCCACAGAGCCCGCAGAAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTTGAACTCACATTCAAC
GAACCGAGGGTTCGGACGATTGTCTGGAGAGGCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCGCGCTTGTCCACAGCCGCGTCACCCGATGAACCAATC
GCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCAGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGCGTG
TCTTAGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAGCTGTAA
AGTGAGCCTCCGCCGCGCTCGCGCGACCAAGTCGATGGTTTTCGACTTTGAGAATGAGAGTTTGTAACGTACACCTCTTCATTCTGATTGGTCGGTAAAC
CGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGCTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTACAAGG
TACCAAGGTCGTCCGAAGCCAACCATTGGCTGATGACATTGCTTTTCTATAGATCACTTATAGTTTGTATTTAACCCAAGCTTTATCTACCTATAAATAT
GCTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCCCTCTTTAACTAAAGAGGGGACCTGTGAACTGCCGTTCACTACTAAACTGAGAGTTTGTATAC
TCTCGGAAAATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACAGATA